Multiple sequence alignment - TraesCS5D01G345600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G345600 chr5D 100.000 2216 0 0 1 2216 432403679 432405894 0 4093
1 TraesCS5D01G345600 chr5D 97.955 2200 41 4 1 2197 6188758 6186560 0 3810
2 TraesCS5D01G345600 chr5D 97.909 2200 41 5 1 2197 503278408 503280605 0 3803
3 TraesCS5D01G345600 chr1D 97.956 2202 38 7 1 2197 254398291 254400490 0 3810
4 TraesCS5D01G345600 chr3D 97.910 2201 38 8 1 2197 589279724 589281920 0 3803
5 TraesCS5D01G345600 chr1A 97.610 2176 39 6 1 2172 554512066 554509900 0 3718
6 TraesCS5D01G345600 chr5A 96.412 2202 71 8 1 2197 607274218 607272020 0 3622
7 TraesCS5D01G345600 chr4A 95.928 2210 74 12 1 2197 309514949 309512743 0 3568
8 TraesCS5D01G345600 chr4A 95.279 2224 71 19 1 2197 310738415 310736199 0 3494
9 TraesCS5D01G345600 chr4B 95.595 2202 77 9 1 2197 308696288 308694102 0 3511
10 TraesCS5D01G345600 chr6D 97.565 1848 38 6 356 2197 45519037 45517191 0 3157
11 TraesCS5D01G345600 chrUn 97.951 1269 22 4 1 1266 216521582 216520315 0 2196


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G345600 chr5D 432403679 432405894 2215 False 4093 4093 100.000 1 2216 1 chr5D.!!$F1 2215
1 TraesCS5D01G345600 chr5D 6186560 6188758 2198 True 3810 3810 97.955 1 2197 1 chr5D.!!$R1 2196
2 TraesCS5D01G345600 chr5D 503278408 503280605 2197 False 3803 3803 97.909 1 2197 1 chr5D.!!$F2 2196
3 TraesCS5D01G345600 chr1D 254398291 254400490 2199 False 3810 3810 97.956 1 2197 1 chr1D.!!$F1 2196
4 TraesCS5D01G345600 chr3D 589279724 589281920 2196 False 3803 3803 97.910 1 2197 1 chr3D.!!$F1 2196
5 TraesCS5D01G345600 chr1A 554509900 554512066 2166 True 3718 3718 97.610 1 2172 1 chr1A.!!$R1 2171
6 TraesCS5D01G345600 chr5A 607272020 607274218 2198 True 3622 3622 96.412 1 2197 1 chr5A.!!$R1 2196
7 TraesCS5D01G345600 chr4A 309512743 309514949 2206 True 3568 3568 95.928 1 2197 1 chr4A.!!$R1 2196
8 TraesCS5D01G345600 chr4A 310736199 310738415 2216 True 3494 3494 95.279 1 2197 1 chr4A.!!$R2 2196
9 TraesCS5D01G345600 chr4B 308694102 308696288 2186 True 3511 3511 95.595 1 2197 1 chr4B.!!$R1 2196
10 TraesCS5D01G345600 chr6D 45517191 45519037 1846 True 3157 3157 97.565 356 2197 1 chr6D.!!$R1 1841
11 TraesCS5D01G345600 chrUn 216520315 216521582 1267 True 2196 2196 97.951 1 1266 1 chrUn.!!$R1 1265

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
607 629 2.210644 CAACCCCTTGGGGTTATCCTA 58.789 52.381 34.97 0.0 42.24 2.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1982 2026 1.236616 TGCGTCCTTGGATTGCTGTG 61.237 55.0 14.72 0.0 0.0 3.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
64 83 7.905265 AGGATGTAGAAGATCATAACATGAGG 58.095 38.462 0.00 0.00 43.53 3.86
287 307 5.149273 GCCATGCATAACATAGAAATCACG 58.851 41.667 0.00 0.00 36.64 4.35
336 356 2.288395 GCAGCAGGTGTTGTAGCAAAAT 60.288 45.455 0.66 0.00 0.00 1.82
607 629 2.210644 CAACCCCTTGGGGTTATCCTA 58.789 52.381 34.97 0.00 42.24 2.94
892 920 5.163703 CCCTACTTCGATCGAGATATTGGAG 60.164 48.000 18.54 12.31 0.00 3.86
913 942 8.268850 TGGAGATAGAATGCACTCTTTAAAAC 57.731 34.615 1.62 0.00 0.00 2.43
1391 1427 3.550820 TGGAACTTCAACAGCAGCTAAA 58.449 40.909 0.00 0.00 0.00 1.85
1421 1457 3.496884 GGAAGTTGTGAGCATTACGTTCA 59.503 43.478 0.00 0.00 31.59 3.18
1489 1525 5.050567 CCCAAGTATTAATAACGCGACCTTC 60.051 44.000 15.93 0.00 0.00 3.46
1749 1792 7.020827 TCATTTTCAGTAGTTTCCCTGATCT 57.979 36.000 0.00 0.00 37.54 2.75
1823 1866 7.040892 CCGAATACACTAGCTACACCTAACATA 60.041 40.741 0.00 0.00 0.00 2.29
1982 2026 1.336125 GCAACAGGAGCTGAATATGCC 59.664 52.381 0.00 0.00 35.18 4.40
2197 2242 6.851222 AGCACCAGAGATAATATTGTTTCG 57.149 37.500 0.00 0.00 0.00 3.46
2198 2243 6.349300 AGCACCAGAGATAATATTGTTTCGT 58.651 36.000 0.00 0.00 0.00 3.85
2199 2244 6.480320 AGCACCAGAGATAATATTGTTTCGTC 59.520 38.462 0.00 0.00 0.00 4.20
2200 2245 6.257849 GCACCAGAGATAATATTGTTTCGTCA 59.742 38.462 0.00 0.00 0.00 4.35
2201 2246 7.201609 GCACCAGAGATAATATTGTTTCGTCAA 60.202 37.037 0.00 0.00 0.00 3.18
2202 2247 8.664798 CACCAGAGATAATATTGTTTCGTCAAA 58.335 33.333 0.00 0.00 0.00 2.69
2203 2248 9.226606 ACCAGAGATAATATTGTTTCGTCAAAA 57.773 29.630 0.00 0.00 0.00 2.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 2.545113 GCGTTCCGTCATCTGGCTTATA 60.545 50.000 0.00 0.00 0.00 0.98
64 83 2.294512 GGAATCCAAATCTGCCGAATCC 59.705 50.000 0.00 0.00 0.00 3.01
101 120 9.445878 GAATCATATGATGAAGTACCACATGAT 57.554 33.333 18.85 6.98 43.50 2.45
153 172 9.639601 CATACGGCTTTCTAGATGTATATGAAA 57.360 33.333 0.00 0.00 0.00 2.69
154 173 7.759886 GCATACGGCTTTCTAGATGTATATGAA 59.240 37.037 0.00 0.00 40.25 2.57
336 356 5.336372 CCGATTTACCCTCTTTTGCAATGAA 60.336 40.000 0.00 0.00 0.00 2.57
607 629 2.897969 TCCTAGTTCTTCTTCCAAGCGT 59.102 45.455 0.00 0.00 0.00 5.07
870 898 6.729391 TCTCCAATATCTCGATCGAAGTAG 57.271 41.667 19.92 7.52 0.00 2.57
892 920 7.303634 TCCGTTTTAAAGAGTGCATTCTATC 57.696 36.000 12.63 0.00 0.00 2.08
1267 1302 9.998106 GTTCTAGCAAGATATTGGGTATTTCTA 57.002 33.333 1.67 0.00 0.00 2.10
1391 1427 3.445008 TGCTCACAACTTCCCTCTAGAT 58.555 45.455 0.00 0.00 0.00 1.98
1421 1457 5.129368 ACCTTGGTATGGAAGTAATGCAT 57.871 39.130 0.00 0.00 43.28 3.96
1489 1525 7.905604 TTCAACCAATCTGTAGTTGATAGTG 57.094 36.000 5.72 0.00 46.64 2.74
1749 1792 5.405279 TGGTTCCTTGGTAACCTCTAGTTA 58.595 41.667 16.24 0.00 45.53 2.24
1823 1866 5.006896 ACATCCTTATGCATCCATTCCAT 57.993 39.130 0.19 0.00 36.50 3.41
1982 2026 1.236616 TGCGTCCTTGGATTGCTGTG 61.237 55.000 14.72 0.00 0.00 3.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.