Multiple sequence alignment - TraesCS5D01G345500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G345500 chr5D 100.000 2219 0 0 1 2219 432403371 432405589 0 4098
1 TraesCS5D01G345500 chr5D 97.615 2222 48 5 1 2219 503278100 503280319 0 3805
2 TraesCS5D01G345500 chr5D 97.570 2222 50 4 1 2219 6189066 6186846 0 3801
3 TraesCS5D01G345500 chr5D 97.844 1577 29 5 1 1574 503218344 503216770 0 2719
4 TraesCS5D01G345500 chr3D 97.661 2223 45 7 1 2219 589279416 589281635 0 3810
5 TraesCS5D01G345500 chr1D 97.570 2222 47 7 3 2219 254397985 254400204 0 3797
6 TraesCS5D01G345500 chr1A 97.391 2223 45 6 1 2219 554512374 554510161 0 3771
7 TraesCS5D01G345500 chr5A 96.403 2224 72 8 1 2219 607274526 607272306 0 3657
8 TraesCS5D01G345500 chr4A 95.565 2232 83 12 1 2219 309515257 309513029 0 3559
9 TraesCS5D01G345500 chr4A 94.920 2244 82 17 1 2219 310738723 310736487 0 3483
10 TraesCS5D01G345500 chr6D 97.844 1577 30 4 1 1574 168255052 168253477 0 2721


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G345500 chr5D 432403371 432405589 2218 False 4098 4098 100.000 1 2219 1 chr5D.!!$F1 2218
1 TraesCS5D01G345500 chr5D 503278100 503280319 2219 False 3805 3805 97.615 1 2219 1 chr5D.!!$F2 2218
2 TraesCS5D01G345500 chr5D 6186846 6189066 2220 True 3801 3801 97.570 1 2219 1 chr5D.!!$R1 2218
3 TraesCS5D01G345500 chr5D 503216770 503218344 1574 True 2719 2719 97.844 1 1574 1 chr5D.!!$R2 1573
4 TraesCS5D01G345500 chr3D 589279416 589281635 2219 False 3810 3810 97.661 1 2219 1 chr3D.!!$F1 2218
5 TraesCS5D01G345500 chr1D 254397985 254400204 2219 False 3797 3797 97.570 3 2219 1 chr1D.!!$F1 2216
6 TraesCS5D01G345500 chr1A 554510161 554512374 2213 True 3771 3771 97.391 1 2219 1 chr1A.!!$R1 2218
7 TraesCS5D01G345500 chr5A 607272306 607274526 2220 True 3657 3657 96.403 1 2219 1 chr5A.!!$R1 2218
8 TraesCS5D01G345500 chr4A 309513029 309515257 2228 True 3559 3559 95.565 1 2219 1 chr4A.!!$R1 2218
9 TraesCS5D01G345500 chr4A 310736487 310738723 2236 True 3483 3483 94.920 1 2219 1 chr4A.!!$R2 2218
10 TraesCS5D01G345500 chr6D 168253477 168255052 1575 True 2721 2721 97.844 1 1574 1 chr6D.!!$R1 1573

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
915 935 2.210644 CAACCCCTTGGGGTTATCCTA 58.789 52.381 34.97 0.0 42.24 2.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2131 2171 5.006896 ACATCCTTATGCATCCATTCCAT 57.993 39.13 0.19 0.0 36.5 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
250 251 5.532664 AAATAGGGATGTCTCCTACGTTC 57.467 43.478 0.00 0.00 41.74 3.95
296 297 5.032863 ACGTAATTTCATAGAGTCGTTCGG 58.967 41.667 0.00 0.00 0.00 4.30
300 301 6.446781 AATTTCATAGAGTCGTTCGGTCTA 57.553 37.500 7.34 7.34 0.00 2.59
317 318 6.582636 TCGGTCTAAATGCTACATGAAGAAT 58.417 36.000 0.00 0.00 0.00 2.40
372 391 7.905265 AGGATGTAGAAGATCATAACATGAGG 58.095 38.462 0.00 0.00 43.53 3.86
595 615 5.149273 GCCATGCATAACATAGAAATCACG 58.851 41.667 0.00 0.00 36.64 4.35
644 664 2.288395 GCAGCAGGTGTTGTAGCAAAAT 60.288 45.455 0.66 0.00 0.00 1.82
915 935 2.210644 CAACCCCTTGGGGTTATCCTA 58.789 52.381 34.97 0.00 42.24 2.94
1200 1228 5.163703 CCCTACTTCGATCGAGATATTGGAG 60.164 48.000 18.54 12.31 0.00 3.86
1221 1250 8.268850 TGGAGATAGAATGCACTCTTTAAAAC 57.731 34.615 1.62 0.00 0.00 2.43
1699 1732 3.550820 TGGAACTTCAACAGCAGCTAAA 58.449 40.909 0.00 0.00 0.00 1.85
1729 1762 3.496884 GGAAGTTGTGAGCATTACGTTCA 59.503 43.478 0.00 0.00 31.59 3.18
1797 1830 5.050567 CCCAAGTATTAATAACGCGACCTTC 60.051 44.000 15.93 0.00 0.00 3.46
2057 2097 7.020827 TCATTTTCAGTAGTTTCCCTGATCT 57.979 36.000 0.00 0.00 37.54 2.75
2131 2171 7.040892 CCGAATACACTAGCTACACCTAACATA 60.041 40.741 0.00 0.00 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 3.115554 GTTCTGTGCGTGCTTCAAATTT 58.884 40.909 0.00 0.00 0.00 1.82
100 101 2.543653 GGTTCTGTGCGTGCTTCAAATT 60.544 45.455 0.00 0.00 0.00 1.82
101 102 1.001378 GGTTCTGTGCGTGCTTCAAAT 60.001 47.619 0.00 0.00 0.00 2.32
291 292 5.810587 TCTTCATGTAGCATTTAGACCGAAC 59.189 40.000 0.00 0.00 0.00 3.95
300 301 8.696043 TGGCTTATATTCTTCATGTAGCATTT 57.304 30.769 0.00 0.00 0.00 2.32
317 318 2.545113 GCGTTCCGTCATCTGGCTTATA 60.545 50.000 0.00 0.00 0.00 0.98
372 391 2.294512 GGAATCCAAATCTGCCGAATCC 59.705 50.000 0.00 0.00 0.00 3.01
409 428 9.445878 GAATCATATGATGAAGTACCACATGAT 57.554 33.333 18.85 6.98 43.50 2.45
461 480 9.639601 CATACGGCTTTCTAGATGTATATGAAA 57.360 33.333 0.00 0.00 0.00 2.69
462 481 7.759886 GCATACGGCTTTCTAGATGTATATGAA 59.240 37.037 0.00 0.00 40.25 2.57
644 664 5.336372 CCGATTTACCCTCTTTTGCAATGAA 60.336 40.000 0.00 0.00 0.00 2.57
915 935 2.897969 TCCTAGTTCTTCTTCCAAGCGT 59.102 45.455 0.00 0.00 0.00 5.07
1178 1206 6.729391 TCTCCAATATCTCGATCGAAGTAG 57.271 41.667 19.92 7.52 0.00 2.57
1200 1228 7.303634 TCCGTTTTAAAGAGTGCATTCTATC 57.696 36.000 12.63 0.00 0.00 2.08
1575 1607 9.998106 GTTCTAGCAAGATATTGGGTATTTCTA 57.002 33.333 1.67 0.00 0.00 2.10
1699 1732 3.445008 TGCTCACAACTTCCCTCTAGAT 58.555 45.455 0.00 0.00 0.00 1.98
1729 1762 5.129368 ACCTTGGTATGGAAGTAATGCAT 57.871 39.130 0.00 0.00 43.28 3.96
1797 1830 7.905604 TTCAACCAATCTGTAGTTGATAGTG 57.094 36.000 5.72 0.00 46.64 2.74
2057 2097 5.405279 TGGTTCCTTGGTAACCTCTAGTTA 58.595 41.667 16.24 0.00 45.53 2.24
2131 2171 5.006896 ACATCCTTATGCATCCATTCCAT 57.993 39.130 0.19 0.00 36.50 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.