Multiple sequence alignment - TraesCS5D01G344900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G344900 chr5D 100.000 2378 0 0 1 2378 432329034 432326657 0.000000e+00 4392
1 TraesCS5D01G344900 chr5D 97.754 1514 32 2 1 1513 503224041 503222529 0.000000e+00 2606
2 TraesCS5D01G344900 chr5D 95.291 892 15 2 1508 2376 503345948 503346835 0.000000e+00 1389
3 TraesCS5D01G344900 chr5D 94.961 893 17 2 1508 2376 503320012 503320900 0.000000e+00 1375
4 TraesCS5D01G344900 chr5D 94.860 895 18 2 1508 2378 6246760 6245870 0.000000e+00 1373
5 TraesCS5D01G344900 chr3B 98.018 1514 29 1 1 1513 101917002 101915489 0.000000e+00 2628
6 TraesCS5D01G344900 chr3B 95.084 895 16 2 1508 2378 201478923 201479813 0.000000e+00 1384
7 TraesCS5D01G344900 chr3D 97.886 1514 31 1 1 1513 589271134 589272647 0.000000e+00 2617
8 TraesCS5D01G344900 chr3A 97.754 1514 33 1 1 1513 495095321 495093808 0.000000e+00 2606
9 TraesCS5D01G344900 chr2B 97.688 1514 33 2 1 1513 449212109 449210597 0.000000e+00 2601
10 TraesCS5D01G344900 chr2B 94.972 895 17 2 1508 2378 683734914 683735804 0.000000e+00 1378
11 TraesCS5D01G344900 chrUn 97.688 1514 32 2 1 1513 216512783 216514294 0.000000e+00 2599
12 TraesCS5D01G344900 chrUn 97.688 1514 32 2 1 1513 286270600 286269089 0.000000e+00 2599
13 TraesCS5D01G344900 chrUn 94.782 824 15 3 1579 2378 298937380 298936561 0.000000e+00 1258
14 TraesCS5D01G344900 chrUn 89.457 313 9 1 2090 2378 209402258 209401946 8.030000e-100 374
15 TraesCS5D01G344900 chrUn 89.457 313 9 1 2090 2378 267896050 267896362 8.030000e-100 374
16 TraesCS5D01G344900 chrUn 89.457 313 9 1 2090 2378 427609631 427609319 8.030000e-100 374
17 TraesCS5D01G344900 chr7A 97.556 1514 36 1 1 1513 699866809 699868322 0.000000e+00 2590
18 TraesCS5D01G344900 chr1A 97.556 1514 36 1 1 1513 278531159 278532672 0.000000e+00 2590
19 TraesCS5D01G344900 chr1A 95.516 892 12 2 1508 2375 554488543 554489430 0.000000e+00 1400
20 TraesCS5D01G344900 chr7B 95.196 895 15 2 1508 2378 716767368 716766478 0.000000e+00 1389
21 TraesCS5D01G344900 chr7B 95.089 896 15 3 1508 2378 716812749 716813640 0.000000e+00 1384
22 TraesCS5D01G344900 chr7B 94.860 895 17 6 1508 2378 662748555 662747666 0.000000e+00 1371
23 TraesCS5D01G344900 chr1D 94.754 896 18 3 1508 2378 254465922 254466813 0.000000e+00 1367
24 TraesCS5D01G344900 chr1D 94.308 896 22 3 1508 2378 351090788 351089897 0.000000e+00 1345
25 TraesCS5D01G344900 chr1D 92.984 898 32 5 1508 2378 244190450 244191343 0.000000e+00 1280
26 TraesCS5D01G344900 chr1D 97.333 75 2 0 2304 2378 244758462 244758536 6.900000e-26 128
27 TraesCS5D01G344900 chr4D 90.096 313 7 1 2090 2378 123674282 123673970 3.710000e-103 385


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G344900 chr5D 432326657 432329034 2377 True 4392 4392 100.000 1 2378 1 chr5D.!!$R2 2377
1 TraesCS5D01G344900 chr5D 503222529 503224041 1512 True 2606 2606 97.754 1 1513 1 chr5D.!!$R3 1512
2 TraesCS5D01G344900 chr5D 503345948 503346835 887 False 1389 1389 95.291 1508 2376 1 chr5D.!!$F2 868
3 TraesCS5D01G344900 chr5D 503320012 503320900 888 False 1375 1375 94.961 1508 2376 1 chr5D.!!$F1 868
4 TraesCS5D01G344900 chr5D 6245870 6246760 890 True 1373 1373 94.860 1508 2378 1 chr5D.!!$R1 870
5 TraesCS5D01G344900 chr3B 101915489 101917002 1513 True 2628 2628 98.018 1 1513 1 chr3B.!!$R1 1512
6 TraesCS5D01G344900 chr3B 201478923 201479813 890 False 1384 1384 95.084 1508 2378 1 chr3B.!!$F1 870
7 TraesCS5D01G344900 chr3D 589271134 589272647 1513 False 2617 2617 97.886 1 1513 1 chr3D.!!$F1 1512
8 TraesCS5D01G344900 chr3A 495093808 495095321 1513 True 2606 2606 97.754 1 1513 1 chr3A.!!$R1 1512
9 TraesCS5D01G344900 chr2B 449210597 449212109 1512 True 2601 2601 97.688 1 1513 1 chr2B.!!$R1 1512
10 TraesCS5D01G344900 chr2B 683734914 683735804 890 False 1378 1378 94.972 1508 2378 1 chr2B.!!$F1 870
11 TraesCS5D01G344900 chrUn 216512783 216514294 1511 False 2599 2599 97.688 1 1513 1 chrUn.!!$F1 1512
12 TraesCS5D01G344900 chrUn 286269089 286270600 1511 True 2599 2599 97.688 1 1513 1 chrUn.!!$R2 1512
13 TraesCS5D01G344900 chrUn 298936561 298937380 819 True 1258 1258 94.782 1579 2378 1 chrUn.!!$R3 799
14 TraesCS5D01G344900 chr7A 699866809 699868322 1513 False 2590 2590 97.556 1 1513 1 chr7A.!!$F1 1512
15 TraesCS5D01G344900 chr1A 278531159 278532672 1513 False 2590 2590 97.556 1 1513 1 chr1A.!!$F1 1512
16 TraesCS5D01G344900 chr1A 554488543 554489430 887 False 1400 1400 95.516 1508 2375 1 chr1A.!!$F2 867
17 TraesCS5D01G344900 chr7B 716766478 716767368 890 True 1389 1389 95.196 1508 2378 1 chr7B.!!$R2 870
18 TraesCS5D01G344900 chr7B 716812749 716813640 891 False 1384 1384 95.089 1508 2378 1 chr7B.!!$F1 870
19 TraesCS5D01G344900 chr7B 662747666 662748555 889 True 1371 1371 94.860 1508 2378 1 chr7B.!!$R1 870
20 TraesCS5D01G344900 chr1D 254465922 254466813 891 False 1367 1367 94.754 1508 2378 1 chr1D.!!$F3 870
21 TraesCS5D01G344900 chr1D 351089897 351090788 891 True 1345 1345 94.308 1508 2378 1 chr1D.!!$R1 870
22 TraesCS5D01G344900 chr1D 244190450 244191343 893 False 1280 1280 92.984 1508 2378 1 chr1D.!!$F1 870

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
866 867 0.612174 TTCGACTCTGACTCCCCCAG 60.612 60.0 0.0 0.0 0.0 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2328 2357 0.178981 ACAGCTCCTGGTGCAACAAT 60.179 50.0 21.49 0.0 44.77 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
371 372 5.534207 AACAGATCCATTTTGCAAGTTCA 57.466 34.783 0.00 0.0 0.00 3.18
591 592 4.287067 TCAACCTTTCTGACTTGCTCCTAT 59.713 41.667 0.00 0.0 0.00 2.57
776 777 6.094061 AGACGAGGTCTTCTTTCTTTTATCG 58.906 40.000 0.00 0.0 40.28 2.92
781 782 7.222999 CGAGGTCTTCTTTCTTTTATCGCTTAT 59.777 37.037 0.00 0.0 0.00 1.73
808 809 2.606725 GTGCGAGATGAAAGTCTCATGG 59.393 50.000 4.96 0.0 45.23 3.66
834 835 4.022503 GGTTTTGCATGAGAGAAAGAAGCT 60.023 41.667 0.00 0.0 0.00 3.74
866 867 0.612174 TTCGACTCTGACTCCCCCAG 60.612 60.000 0.00 0.0 0.00 4.45
873 874 4.234673 GACTCCCCCAGTCCAGTT 57.765 61.111 0.00 0.0 45.47 3.16
932 933 1.425428 CTTCAGCCACGCGAATTCC 59.575 57.895 15.93 0.0 0.00 3.01
1046 1047 7.083858 GCTATTACTCAAACAAGCATGAAACA 58.916 34.615 0.00 0.0 32.25 2.83
1216 1217 4.942761 TTTGGTCTACGTACTGGAACTT 57.057 40.909 0.00 0.0 0.00 2.66
1364 1365 1.604593 GGTGTGGATGGCAAGCAGT 60.605 57.895 0.00 0.0 0.00 4.40
1376 1377 5.887214 TGGCAAGCAGTCCTATATTTCTA 57.113 39.130 0.00 0.0 0.00 2.10
1416 1417 8.211116 TCCTTACGAGTGTTCTTTCTATCTAG 57.789 38.462 0.00 0.0 0.00 2.43
1592 1594 6.070656 CCATAATGCCTTTCAAATCCTCCTA 58.929 40.000 0.00 0.0 0.00 2.94
1593 1595 6.208204 CCATAATGCCTTTCAAATCCTCCTAG 59.792 42.308 0.00 0.0 0.00 3.02
1594 1596 3.004752 TGCCTTTCAAATCCTCCTAGC 57.995 47.619 0.00 0.0 0.00 3.42
1595 1597 2.578021 TGCCTTTCAAATCCTCCTAGCT 59.422 45.455 0.00 0.0 0.00 3.32
1701 1703 2.201732 CAGCGCGTCCTTGTATAATGT 58.798 47.619 8.43 0.0 0.00 2.71
1914 1917 1.363807 GCCTGTGCCCACAAGAAAC 59.636 57.895 2.45 0.0 41.33 2.78
1937 1940 1.597663 CGAAGCCACCCATTAATCGTC 59.402 52.381 0.00 0.0 0.00 4.20
2030 2034 3.410631 TCCGACTGCATTTTCCAACTA 57.589 42.857 0.00 0.0 0.00 2.24
2115 2119 3.431626 CCAGGCGGATACTTGACATGTTA 60.432 47.826 0.00 0.0 0.00 2.41
2177 2181 7.607991 CCTAGATTTGCTTTATCGGGTATCAAT 59.392 37.037 0.00 0.0 0.00 2.57
2328 2357 4.158394 CACCCCACGTTAAGCTAGTACTTA 59.842 45.833 0.00 0.0 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
509 510 4.515361 CCATGAGATGATCATCTTAGGGC 58.485 47.826 34.39 23.85 46.01 5.19
591 592 1.133363 TCCTTTCGACCTTGGTTCCA 58.867 50.000 0.00 0.00 0.00 3.53
687 688 3.799137 TCCGTTCTTTTTCGAAATCGG 57.201 42.857 12.12 18.27 40.29 4.18
704 705 3.850273 GCGTATGTATAAGACCGAATCCG 59.150 47.826 0.00 0.00 0.00 4.18
759 760 7.848539 GCTCATAAGCGATAAAAGAAAGAAGAC 59.151 37.037 0.00 0.00 39.10 3.01
781 782 0.737367 CTTTCATCTCGCACGGCTCA 60.737 55.000 0.00 0.00 0.00 4.26
808 809 3.498397 TCTTTCTCTCATGCAAAACCGTC 59.502 43.478 0.00 0.00 0.00 4.79
834 835 5.125739 GTCAGAGTCGAAAAGAGGATTCCTA 59.874 44.000 4.86 0.00 31.76 2.94
866 867 4.800471 CAGAAAGAAAAGCAACAACTGGAC 59.200 41.667 0.00 0.00 0.00 4.02
873 874 6.092944 TCGAAGTAACAGAAAGAAAAGCAACA 59.907 34.615 0.00 0.00 0.00 3.33
1004 1005 2.521547 AGCAAGGAGATTCCCCAAAG 57.478 50.000 0.00 0.00 37.19 2.77
1106 1107 6.628919 TTGCATATCCATCATTTGAGTCTG 57.371 37.500 0.00 0.00 0.00 3.51
1263 1264 2.625790 ACATAGGGCTAAAGAGAGAGCG 59.374 50.000 0.00 0.00 39.72 5.03
1337 1338 2.092968 TGCCATCCACACCAGAATAGAC 60.093 50.000 0.00 0.00 0.00 2.59
1376 1377 5.021458 TCGTAAGGAGTCCTATTGAAACCT 58.979 41.667 13.43 0.00 33.83 3.50
1592 1594 2.243810 GCAGTAGGATAGTGGCTAGCT 58.756 52.381 15.72 0.00 42.28 3.32
1593 1595 1.964223 TGCAGTAGGATAGTGGCTAGC 59.036 52.381 6.04 6.04 42.28 3.42
1594 1596 4.881019 ATTGCAGTAGGATAGTGGCTAG 57.119 45.455 0.00 0.00 42.28 3.42
1595 1597 6.935240 ATTATTGCAGTAGGATAGTGGCTA 57.065 37.500 0.00 0.00 42.28 3.93
1701 1703 1.944177 ACTCAGCCTAGAGCCTTGAA 58.056 50.000 0.00 0.00 45.47 2.69
1914 1917 2.222027 GATTAATGGGTGGCTTCGAGG 58.778 52.381 0.00 0.00 0.00 4.63
1937 1940 3.996150 AACTTTGCACAGAGTTCCATG 57.004 42.857 6.92 0.00 31.03 3.66
2030 2034 7.117667 GCAATTTCGGTAGTCATTTTCCATTTT 59.882 33.333 0.00 0.00 0.00 1.82
2076 2080 4.526970 GCCTGGGATCATGTTTTCTTAGA 58.473 43.478 0.00 0.00 0.00 2.10
2328 2357 0.178981 ACAGCTCCTGGTGCAACAAT 60.179 50.000 21.49 0.00 44.77 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.