Multiple sequence alignment - TraesCS5D01G343900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G343900 chr5D 100.000 2471 0 0 982 3452 431707903 431705433 0.000000e+00 4564.0
1 TraesCS5D01G343900 chr5D 98.180 2473 28 4 982 3452 433701632 433704089 0.000000e+00 4301.0
2 TraesCS5D01G343900 chr5D 97.859 2476 47 4 982 3452 513289701 513287227 0.000000e+00 4274.0
3 TraesCS5D01G343900 chr5D 95.989 2468 68 8 990 3452 513205926 513203485 0.000000e+00 3980.0
4 TraesCS5D01G343900 chr5D 87.704 1350 122 23 1005 2327 433510665 433509333 0.000000e+00 1533.0
5 TraesCS5D01G343900 chr5D 100.000 543 0 0 1 543 431708884 431708342 0.000000e+00 1003.0
6 TraesCS5D01G343900 chr5D 90.921 738 47 10 1638 2360 433515881 433515149 0.000000e+00 974.0
7 TraesCS5D01G343900 chr5D 90.382 707 35 9 1709 2403 431889274 431889959 0.000000e+00 898.0
8 TraesCS5D01G343900 chr5D 85.561 187 21 4 2722 2905 431890302 431890485 1.260000e-44 191.0
9 TraesCS5D01G343900 chr5D 85.561 187 21 3 2722 2905 433514765 433514582 1.260000e-44 191.0
10 TraesCS5D01G343900 chr5B 97.210 2473 61 6 988 3452 522908278 522910750 0.000000e+00 4178.0
11 TraesCS5D01G343900 chr5B 96.913 2462 68 6 999 3452 522370375 522367914 0.000000e+00 4119.0
12 TraesCS5D01G343900 chr5B 88.478 1432 123 19 999 2415 524389479 524388075 0.000000e+00 1692.0
13 TraesCS5D01G343900 chr5B 86.682 1284 123 17 996 2237 522926609 522927886 0.000000e+00 1380.0
14 TraesCS5D01G343900 chr5B 88.331 617 36 6 1799 2403 522622980 522622388 0.000000e+00 708.0
15 TraesCS5D01G343900 chr5B 85.561 187 21 3 2722 2905 522622045 522621862 1.260000e-44 191.0
16 TraesCS5D01G343900 chr5B 85.561 187 20 5 2722 2905 522916988 522917170 4.550000e-44 189.0
17 TraesCS5D01G343900 chr5B 100.000 46 0 0 2903 2948 524362416 524362371 6.140000e-13 86.1
18 TraesCS5D01G343900 chr5A 86.397 1360 137 21 995 2327 546790070 546791408 0.000000e+00 1443.0
19 TraesCS5D01G343900 chr5A 97.297 37 1 0 2900 2936 546793534 546793570 2.880000e-06 63.9
20 TraesCS5D01G343900 chr1D 97.624 505 8 2 2949 3452 480435121 480435622 0.000000e+00 863.0
21 TraesCS5D01G343900 chr1B 97.619 504 10 2 2949 3450 668759889 668760392 0.000000e+00 863.0
22 TraesCS5D01G343900 chr1A 95.030 503 23 2 2949 3449 576780780 576781282 0.000000e+00 789.0
23 TraesCS5D01G343900 chr6B 91.697 542 15 14 1 541 712393279 712393791 0.000000e+00 725.0
24 TraesCS5D01G343900 chr6A 90.074 544 27 3 1 543 610266360 610266877 0.000000e+00 680.0
25 TraesCS5D01G343900 chr3A 92.798 361 23 3 1 360 687130077 687130435 1.420000e-143 520.0
26 TraesCS5D01G343900 chr3A 92.913 127 6 3 346 470 687130382 687130507 7.610000e-42 182.0
27 TraesCS5D01G343900 chr3A 91.860 86 6 1 459 543 687127651 687127566 6.050000e-23 119.0
28 TraesCS5D01G343900 chr7B 91.989 362 23 6 1 360 570108199 570108556 1.430000e-138 503.0
29 TraesCS5D01G343900 chr7B 94.975 199 8 2 346 543 570108505 570108702 9.300000e-81 311.0
30 TraesCS5D01G343900 chr4A 91.967 361 26 3 1 360 210944387 210944745 1.430000e-138 503.0
31 TraesCS5D01G343900 chr4A 93.035 201 11 3 346 543 210944692 210944892 1.210000e-74 291.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G343900 chr5D 431705433 431708884 3451 True 2783.500000 4564 100.0000 1 3452 2 chr5D.!!$R3 3451
1 TraesCS5D01G343900 chr5D 433701632 433704089 2457 False 4301.000000 4301 98.1800 982 3452 1 chr5D.!!$F1 2470
2 TraesCS5D01G343900 chr5D 513287227 513289701 2474 True 4274.000000 4274 97.8590 982 3452 1 chr5D.!!$R2 2470
3 TraesCS5D01G343900 chr5D 513203485 513205926 2441 True 3980.000000 3980 95.9890 990 3452 1 chr5D.!!$R1 2462
4 TraesCS5D01G343900 chr5D 433509333 433515881 6548 True 899.333333 1533 88.0620 1005 2905 3 chr5D.!!$R4 1900
5 TraesCS5D01G343900 chr5D 431889274 431890485 1211 False 544.500000 898 87.9715 1709 2905 2 chr5D.!!$F2 1196
6 TraesCS5D01G343900 chr5B 522908278 522910750 2472 False 4178.000000 4178 97.2100 988 3452 1 chr5B.!!$F1 2464
7 TraesCS5D01G343900 chr5B 522367914 522370375 2461 True 4119.000000 4119 96.9130 999 3452 1 chr5B.!!$R1 2453
8 TraesCS5D01G343900 chr5B 524388075 524389479 1404 True 1692.000000 1692 88.4780 999 2415 1 chr5B.!!$R3 1416
9 TraesCS5D01G343900 chr5B 522926609 522927886 1277 False 1380.000000 1380 86.6820 996 2237 1 chr5B.!!$F3 1241
10 TraesCS5D01G343900 chr5B 522621862 522622980 1118 True 449.500000 708 86.9460 1799 2905 2 chr5B.!!$R4 1106
11 TraesCS5D01G343900 chr5A 546790070 546793570 3500 False 753.450000 1443 91.8470 995 2936 2 chr5A.!!$F1 1941
12 TraesCS5D01G343900 chr1D 480435121 480435622 501 False 863.000000 863 97.6240 2949 3452 1 chr1D.!!$F1 503
13 TraesCS5D01G343900 chr1B 668759889 668760392 503 False 863.000000 863 97.6190 2949 3450 1 chr1B.!!$F1 501
14 TraesCS5D01G343900 chr1A 576780780 576781282 502 False 789.000000 789 95.0300 2949 3449 1 chr1A.!!$F1 500
15 TraesCS5D01G343900 chr6B 712393279 712393791 512 False 725.000000 725 91.6970 1 541 1 chr6B.!!$F1 540
16 TraesCS5D01G343900 chr6A 610266360 610266877 517 False 680.000000 680 90.0740 1 543 1 chr6A.!!$F1 542
17 TraesCS5D01G343900 chr7B 570108199 570108702 503 False 407.000000 503 93.4820 1 543 2 chr7B.!!$F1 542
18 TraesCS5D01G343900 chr4A 210944387 210944892 505 False 397.000000 503 92.5010 1 543 2 chr4A.!!$F1 542

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
419 422 1.122019 CCCCACTAATCCCCTCCTCG 61.122 65.0 0.0 0.0 0.0 4.63 F
1636 5864 0.032952 GCGTACAGAACCTCCACACA 59.967 55.0 0.0 0.0 0.0 3.72 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2060 6300 2.297701 AGGTTGCATTCTTCGTTGTGT 58.702 42.857 0.00 0.0 0.00 3.72 R
2994 8938 2.177518 AGACCCCTGTCCTGGAGGA 61.178 63.158 6.71 0.0 42.81 3.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 64 6.782494 TCAGAGGGCATAGACATATAGAACAA 59.218 38.462 0.00 0.00 0.00 2.83
63 65 7.039434 TCAGAGGGCATAGACATATAGAACAAG 60.039 40.741 0.00 0.00 0.00 3.16
201 203 1.171308 CCTCTCCAAACCGACGTCTA 58.829 55.000 14.70 0.00 0.00 2.59
419 422 1.122019 CCCCACTAATCCCCTCCTCG 61.122 65.000 0.00 0.00 0.00 4.63
474 478 8.017418 TGAATAGAAAATTCAAAACACCTGGT 57.983 30.769 0.00 0.00 35.35 4.00
500 504 2.462889 GCGGATCGAATAACGTAACCA 58.537 47.619 0.00 0.00 43.13 3.67
1042 5255 0.378257 CATGGCCAATCGTACTGCAC 59.622 55.000 10.96 0.00 0.00 4.57
1106 5322 3.691342 CTGGTTCCCTCCGCACGA 61.691 66.667 0.00 0.00 0.00 4.35
1636 5864 0.032952 GCGTACAGAACCTCCACACA 59.967 55.000 0.00 0.00 0.00 3.72
2994 8938 3.525199 AGGAGGACTCTGTTGGCATATTT 59.475 43.478 0.00 0.00 0.00 1.40
3425 9369 2.981784 TGCCTATTATCAGCTCACCCAT 59.018 45.455 0.00 0.00 0.00 4.00
3436 9381 1.606224 GCTCACCCATTGCAAACAAGG 60.606 52.381 1.71 4.49 39.69 3.61
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 64 1.897802 CCTTCCTGCTGCCATTTTTCT 59.102 47.619 0.00 0.0 0.00 2.52
63 65 1.895131 TCCTTCCTGCTGCCATTTTTC 59.105 47.619 0.00 0.0 0.00 2.29
69 71 4.399395 CGCTCCTTCCTGCTGCCA 62.399 66.667 0.00 0.0 0.00 4.92
419 422 1.807226 GGCGGCCTTTGTTGTATCC 59.193 57.895 12.87 0.0 0.00 2.59
500 504 0.325602 TTCGGGTTTGCGGGTCTATT 59.674 50.000 0.00 0.0 0.00 1.73
2060 6300 2.297701 AGGTTGCATTCTTCGTTGTGT 58.702 42.857 0.00 0.0 0.00 3.72
2994 8938 2.177518 AGACCCCTGTCCTGGAGGA 61.178 63.158 6.71 0.0 42.81 3.71
3425 9369 2.298729 GGTAAGGCATCCTTGTTTGCAA 59.701 45.455 8.29 0.0 44.44 4.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.