Multiple sequence alignment - TraesCS5D01G311100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G311100 chr5D 100.000 3454 0 0 1 3454 407681252 407677799 0 6379
1 TraesCS5D01G311100 chr5D 95.527 939 34 1 2516 3454 407686966 407686036 0 1495
2 TraesCS5D01G311100 chr6D 96.371 3472 98 12 1 3454 349539284 349535823 0 5688
3 TraesCS5D01G311100 chr6D 96.245 3462 93 13 1 3454 349549574 349553006 0 5638
4 TraesCS5D01G311100 chr6D 96.142 2618 81 10 1 2605 82084005 82086615 0 4257
5 TraesCS5D01G311100 chr6D 95.873 2617 88 11 1 2606 82069616 82072223 0 4217
6 TraesCS5D01G311100 chr2D 96.244 3461 108 9 1 3454 38597152 38600597 0 5651
7 TraesCS5D01G311100 chr2D 96.893 3315 85 8 1 3308 38585870 38589173 0 5535
8 TraesCS5D01G311100 chr2D 93.873 963 46 9 2492 3454 38623586 38622637 0 1439
9 TraesCS5D01G311100 chr2D 95.053 849 40 2 2606 3454 38620739 38619893 0 1334
10 TraesCS5D01G311100 chr1A 93.932 3494 134 19 1 3454 513775020 513771565 0 5206
11 TraesCS5D01G311100 chr1A 92.640 2962 160 35 1 2923 574378681 574375739 0 4209
12 TraesCS5D01G311100 chr7A 94.343 3058 106 15 1 3018 80552576 80555606 0 4626
13 TraesCS5D01G311100 chr1D 93.880 2941 151 12 1 2920 116465970 116468902 0 4407
14 TraesCS5D01G311100 chr7D 95.037 947 36 3 2516 3454 587913824 587912881 0 1478
15 TraesCS5D01G311100 chr7D 93.848 959 39 2 2516 3454 558319494 558320452 0 1426
16 TraesCS5D01G311100 chr7D 96.816 848 27 0 2607 3454 587907008 587907855 0 1417


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G311100 chr5D 407677799 407681252 3453 True 6379.0 6379 100.000 1 3454 1 chr5D.!!$R1 3453
1 TraesCS5D01G311100 chr5D 407686036 407686966 930 True 1495.0 1495 95.527 2516 3454 1 chr5D.!!$R2 938
2 TraesCS5D01G311100 chr6D 349535823 349539284 3461 True 5688.0 5688 96.371 1 3454 1 chr6D.!!$R1 3453
3 TraesCS5D01G311100 chr6D 349549574 349553006 3432 False 5638.0 5638 96.245 1 3454 1 chr6D.!!$F3 3453
4 TraesCS5D01G311100 chr6D 82084005 82086615 2610 False 4257.0 4257 96.142 1 2605 1 chr6D.!!$F2 2604
5 TraesCS5D01G311100 chr6D 82069616 82072223 2607 False 4217.0 4217 95.873 1 2606 1 chr6D.!!$F1 2605
6 TraesCS5D01G311100 chr2D 38597152 38600597 3445 False 5651.0 5651 96.244 1 3454 1 chr2D.!!$F2 3453
7 TraesCS5D01G311100 chr2D 38585870 38589173 3303 False 5535.0 5535 96.893 1 3308 1 chr2D.!!$F1 3307
8 TraesCS5D01G311100 chr2D 38619893 38623586 3693 True 1386.5 1439 94.463 2492 3454 2 chr2D.!!$R1 962
9 TraesCS5D01G311100 chr1A 513771565 513775020 3455 True 5206.0 5206 93.932 1 3454 1 chr1A.!!$R1 3453
10 TraesCS5D01G311100 chr1A 574375739 574378681 2942 True 4209.0 4209 92.640 1 2923 1 chr1A.!!$R2 2922
11 TraesCS5D01G311100 chr7A 80552576 80555606 3030 False 4626.0 4626 94.343 1 3018 1 chr7A.!!$F1 3017
12 TraesCS5D01G311100 chr1D 116465970 116468902 2932 False 4407.0 4407 93.880 1 2920 1 chr1D.!!$F1 2919
13 TraesCS5D01G311100 chr7D 587912881 587913824 943 True 1478.0 1478 95.037 2516 3454 1 chr7D.!!$R1 938
14 TraesCS5D01G311100 chr7D 558319494 558320452 958 False 1426.0 1426 93.848 2516 3454 1 chr7D.!!$F1 938
15 TraesCS5D01G311100 chr7D 587907008 587907855 847 False 1417.0 1417 96.816 2607 3454 1 chr7D.!!$F2 847

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
688 690 4.883585 TGTCCAGAAGACCATTATGAATGC 59.116 41.667 0.0 0.0 45.68 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2512 2529 5.063564 GGATTTCTATCAATATTCGGGTCGC 59.936 44.0 0.0 0.0 32.09 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
643 645 5.578336 GCAAGTAAAAATGGCTGAAGAATCC 59.422 40.000 0.00 0.00 0.00 3.01
675 677 4.973168 ACAGCATTTACTTGTCCAGAAGA 58.027 39.130 0.00 0.00 0.00 2.87
688 690 4.883585 TGTCCAGAAGACCATTATGAATGC 59.116 41.667 0.00 0.00 45.68 3.56
722 724 6.591935 CCATTAGGTCTAAAGAATGCACCTA 58.408 40.000 0.00 0.00 38.47 3.08
904 908 5.695816 TCCAAAAAGAAGATGGAAATTTGCG 59.304 36.000 5.16 0.00 40.19 4.85
909 913 5.302357 AGAAGATGGAAATTTGCGAAGAC 57.698 39.130 5.16 0.00 0.00 3.01
1026 1030 8.177119 TGAGTGATAAAAAGGTTTTACAGCAT 57.823 30.769 0.00 0.00 0.00 3.79
1339 1351 6.222389 TCGGGAAGTTACAAATTAAAGACGA 58.778 36.000 0.00 0.00 0.00 4.20
1493 1505 8.691661 AATAGTAAGAAAAGCTCAACCAGAAA 57.308 30.769 0.00 0.00 0.00 2.52
1693 1705 7.623630 AGGCTGAAAATGTTTAAGCCAAATAT 58.376 30.769 24.70 6.86 45.52 1.28
2102 2118 9.793259 CCAAAGGCTAAAGACTATATCCAAATA 57.207 33.333 0.00 0.00 29.55 1.40
2259 2275 8.834465 ACAGTGAATACATAGATCAAGAAATGC 58.166 33.333 0.00 0.00 0.00 3.56
2766 4227 4.613925 ATCGCATGAAGATCTGTATGGT 57.386 40.909 16.76 0.00 0.00 3.55
2883 5813 0.457681 GGCACTCTCTCTCGCACTTC 60.458 60.000 0.00 0.00 0.00 3.01
2967 5919 4.276183 ACATGCATGTACTCTAGTAGGACG 59.724 45.833 30.50 0.00 42.70 4.79
3101 6054 1.890894 GGGAGAGCACGAAGCACTA 59.109 57.895 7.30 0.00 44.53 2.74
3121 6074 4.774726 ACTAAGAGCATCAAGACTCTCCAA 59.225 41.667 0.00 0.00 42.41 3.53
3154 6107 1.203052 TCCTTCGTAGTTTAGGCACCG 59.797 52.381 0.00 0.00 0.00 4.94
3359 6312 7.201750 CGAGTTCTTATGCTAGGGATCCTATAC 60.202 44.444 12.58 0.00 35.36 1.47
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
428 430 8.438676 TTTCTAACTATAAAAGCAGCAGATCC 57.561 34.615 0.00 0.00 0.00 3.36
643 645 3.624777 AGTAAATGCTGTCCAGGGAATG 58.375 45.455 0.00 0.00 0.00 2.67
671 673 8.725148 CATTACTAGGCATTCATAATGGTCTTC 58.275 37.037 0.00 0.00 39.31 2.87
675 677 5.711976 GGCATTACTAGGCATTCATAATGGT 59.288 40.000 0.00 0.00 39.31 3.55
688 690 7.963532 TCTTTAGACCTAATGGCATTACTAGG 58.036 38.462 20.84 20.84 37.52 3.02
904 908 9.710900 ATGACCAAGGAAATTTATTTTGTCTTC 57.289 29.630 14.27 7.19 0.00 2.87
1026 1030 7.469260 GCGCATAGTTTACAATTCCTAAGAAA 58.531 34.615 0.30 0.00 35.09 2.52
1493 1505 5.640147 TGGTGTCTTCAAATAAGACCCATT 58.360 37.500 17.06 0.00 44.47 3.16
1683 1695 8.266473 TGGCTTGAAATTGAATATATTTGGCTT 58.734 29.630 0.00 0.00 0.00 4.35
1693 1705 7.013823 TGGGATTTTGGCTTGAAATTGAATA 57.986 32.000 0.00 0.00 0.00 1.75
1968 1984 9.860898 ATCTTGTCCTTTTATTTTTGCATCTAC 57.139 29.630 0.00 0.00 0.00 2.59
2512 2529 5.063564 GGATTTCTATCAATATTCGGGTCGC 59.936 44.000 0.00 0.00 32.09 5.19
2766 4227 1.467734 GTACCAGTCTTCGCTCTTCGA 59.532 52.381 0.00 0.00 46.88 3.71
2883 5813 9.347934 CAAGCGTGTCCTTCTAATAATATAGAG 57.652 37.037 0.00 0.00 33.64 2.43
2956 5908 3.095911 CACGCGCGTCCTACTAGA 58.904 61.111 35.61 0.00 0.00 2.43
2967 5919 2.581409 ACGGTAGTATGCACGCGC 60.581 61.111 5.73 0.00 39.24 6.86
3101 6054 3.326006 TGTTGGAGAGTCTTGATGCTCTT 59.674 43.478 0.00 0.00 41.63 2.85
3121 6074 0.600255 CGAAGGAAACGGTGCTCTGT 60.600 55.000 0.00 0.00 34.21 3.41
3154 6107 3.231818 TGGCTATTCTACTAGGAGTGGC 58.768 50.000 0.78 0.00 0.00 5.01
3243 6196 4.042271 ACATATGGTTTTCCCTTTCGGT 57.958 40.909 7.80 0.00 39.73 4.69
3323 6276 5.116882 AGCATAAGAACTCGTCCCATAAAC 58.883 41.667 0.00 0.00 0.00 2.01
3359 6312 0.597637 ACACACGCAGAGGTTTCTCG 60.598 55.000 0.00 0.00 44.47 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.