Multiple sequence alignment - TraesCS5D01G290200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G290200 chr5D 100.000 2921 0 0 1 2921 388396033 388393113 0.000000e+00 5395
1 TraesCS5D01G290200 chr5D 97.292 2216 50 8 710 2921 462802150 462804359 0.000000e+00 3751
2 TraesCS5D01G290200 chr5D 99.115 565 5 0 1 565 375303106 375302542 0.000000e+00 1016
3 TraesCS5D01G290200 chr5D 89.172 471 37 7 1089 1545 546919533 546920003 2.520000e-160 575
4 TraesCS5D01G290200 chr5D 98.621 145 2 0 569 713 462800962 462801106 1.040000e-64 257
5 TraesCS5D01G290200 chr5D 90.625 160 13 1 1968 2125 9084842 9084683 8.200000e-51 211
6 TraesCS5D01G290200 chr3D 96.360 2225 53 5 710 2921 22230714 22232923 0.000000e+00 3635
7 TraesCS5D01G290200 chr3D 97.931 145 3 0 569 713 22229525 22229669 4.830000e-63 252
8 TraesCS5D01G290200 chr4B 95.776 1681 53 6 1257 2920 626627893 626626214 0.000000e+00 2695
9 TraesCS5D01G290200 chr4B 87.857 280 34 0 710 989 71021547 71021826 2.170000e-86 329
10 TraesCS5D01G290200 chr4B 88.500 200 19 3 2723 2919 171115792 171115594 3.760000e-59 239
11 TraesCS5D01G290200 chr4B 96.552 87 3 0 1108 1194 626627976 626627890 8.440000e-31 145
12 TraesCS5D01G290200 chr1B 95.969 1439 29 5 734 2170 629472730 629471319 0.000000e+00 2309
13 TraesCS5D01G290200 chr1B 97.462 591 13 2 2332 2921 629467709 629467120 0.000000e+00 1007
14 TraesCS5D01G290200 chr1B 89.336 422 30 6 2241 2650 656522725 656522307 1.550000e-142 516
15 TraesCS5D01G290200 chr1B 81.039 385 46 12 1589 1961 33004096 33003727 6.160000e-72 281
16 TraesCS5D01G290200 chr1B 95.270 148 7 0 569 716 629473934 629473787 4.870000e-58 235
17 TraesCS5D01G290200 chr2D 99.293 566 4 0 1 566 361285243 361284678 0.000000e+00 1024
18 TraesCS5D01G290200 chr2D 97.778 585 10 3 1 584 233971744 233972326 0.000000e+00 1005
19 TraesCS5D01G290200 chr2D 97.440 586 13 2 1 585 634527341 634527925 0.000000e+00 998
20 TraesCS5D01G290200 chr2D 96.615 325 8 3 710 1033 617124556 617124234 1.190000e-148 536
21 TraesCS5D01G290200 chr2D 88.337 403 35 6 2241 2643 617124222 617123832 9.470000e-130 473
22 TraesCS5D01G290200 chr2D 83.333 258 27 10 2677 2921 299081036 299081290 1.050000e-54 224
23 TraesCS5D01G290200 chr2D 98.095 105 2 0 584 688 617125617 617125513 1.790000e-42 183
24 TraesCS5D01G290200 chr1D 99.117 566 5 0 1 566 397126154 397126719 0.000000e+00 1018
25 TraesCS5D01G290200 chr1D 87.952 249 24 4 2678 2921 59022154 59021907 3.680000e-74 289
26 TraesCS5D01G290200 chr7D 99.115 565 5 0 1 565 394196336 394196900 0.000000e+00 1016
27 TraesCS5D01G290200 chr7D 99.113 564 5 0 1 564 65841043 65841606 0.000000e+00 1014
28 TraesCS5D01G290200 chr7D 87.500 160 17 2 1968 2125 415220921 415220763 6.430000e-42 182
29 TraesCS5D01G290200 chr4D 98.774 571 7 0 1 571 319283609 319284179 0.000000e+00 1016
30 TraesCS5D01G290200 chr4D 99.115 565 5 0 1 565 358702561 358703125 0.000000e+00 1016
31 TraesCS5D01G290200 chr4D 90.000 280 28 0 710 989 48416105 48416384 2.140000e-96 363
32 TraesCS5D01G290200 chr4A 88.723 470 40 5 1089 1545 621818352 621817883 1.970000e-156 562
33 TraesCS5D01G290200 chr4A 92.357 157 8 2 1969 2123 739280643 739280489 1.360000e-53 220
34 TraesCS5D01G290200 chr4A 90.566 159 13 1 1969 2125 155768712 155768554 2.950000e-50 209
35 TraesCS5D01G290200 chr4A 93.043 115 8 0 2123 2237 739280031 739280145 5.010000e-38 169
36 TraesCS5D01G290200 chr5B 88.535 471 40 10 1089 1545 690091579 690092049 2.540000e-155 558
37 TraesCS5D01G290200 chr5B 90.000 100 10 0 2677 2776 425672411 425672510 2.360000e-26 130
38 TraesCS5D01G290200 chr2B 96.615 325 8 3 710 1033 485758994 485759316 1.190000e-148 536
39 TraesCS5D01G290200 chr2B 96.012 326 9 4 710 1033 632382608 632382285 7.170000e-146 527
40 TraesCS5D01G290200 chr2B 87.591 411 38 7 2241 2650 632382273 632381875 5.700000e-127 464
41 TraesCS5D01G290200 chr2B 88.701 177 15 3 1951 2125 237983323 237983496 8.200000e-51 211
42 TraesCS5D01G290200 chr2B 87.838 148 14 3 2723 2870 613041062 613040919 1.390000e-38 171
43 TraesCS5D01G290200 chr2B 92.437 119 6 3 2124 2241 237983956 237983840 1.800000e-37 167
44 TraesCS5D01G290200 chr2B 95.238 105 5 0 584 688 485757908 485758012 1.800000e-37 167
45 TraesCS5D01G290200 chr2B 92.857 112 8 0 2126 2237 87532007 87531896 2.330000e-36 163
46 TraesCS5D01G290200 chr6B 95.679 324 11 3 710 1033 681261355 681261035 4.320000e-143 518
47 TraesCS5D01G290200 chr6B 88.049 410 37 6 2241 2650 681261023 681260626 2.630000e-130 475
48 TraesCS5D01G290200 chr6B 96.190 105 4 0 584 688 681262441 681262337 3.870000e-39 172
49 TraesCS5D01G290200 chr6D 94.154 325 16 3 710 1033 423498717 423498395 2.620000e-135 492
50 TraesCS5D01G290200 chr6D 88.152 422 35 6 2241 2650 469906269 469905851 3.380000e-134 488
51 TraesCS5D01G290200 chr6D 86.441 118 13 2 2807 2921 450570309 450570192 3.060000e-25 126
52 TraesCS5D01G290200 chr6D 86.316 95 11 2 2672 2766 450571207 450571115 5.150000e-18 102
53 TraesCS5D01G290200 chr5A 89.796 245 22 1 2680 2921 466854787 466855031 7.860000e-81 311
54 TraesCS5D01G290200 chr5A 93.913 115 7 0 2123 2237 168276209 168276323 1.080000e-39 174
55 TraesCS5D01G290200 chr5A 93.860 114 6 1 2124 2237 671540819 671540707 1.390000e-38 171
56 TraesCS5D01G290200 chr6A 81.299 385 45 12 1590 1962 435765334 435765703 1.320000e-73 287
57 TraesCS5D01G290200 chr1A 81.039 385 46 12 1590 1962 420389600 420389969 6.160000e-72 281
58 TraesCS5D01G290200 chr1A 95.614 114 5 0 2124 2237 581505094 581505207 1.790000e-42 183


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G290200 chr5D 388393113 388396033 2920 True 5395.000000 5395 100.000000 1 2921 1 chr5D.!!$R3 2920
1 TraesCS5D01G290200 chr5D 462800962 462804359 3397 False 2004.000000 3751 97.956500 569 2921 2 chr5D.!!$F2 2352
2 TraesCS5D01G290200 chr5D 375302542 375303106 564 True 1016.000000 1016 99.115000 1 565 1 chr5D.!!$R2 564
3 TraesCS5D01G290200 chr3D 22229525 22232923 3398 False 1943.500000 3635 97.145500 569 2921 2 chr3D.!!$F1 2352
4 TraesCS5D01G290200 chr4B 626626214 626627976 1762 True 1420.000000 2695 96.164000 1108 2920 2 chr4B.!!$R2 1812
5 TraesCS5D01G290200 chr1B 629467120 629473934 6814 True 1183.666667 2309 96.233667 569 2921 3 chr1B.!!$R3 2352
6 TraesCS5D01G290200 chr2D 361284678 361285243 565 True 1024.000000 1024 99.293000 1 566 1 chr2D.!!$R1 565
7 TraesCS5D01G290200 chr2D 233971744 233972326 582 False 1005.000000 1005 97.778000 1 584 1 chr2D.!!$F1 583
8 TraesCS5D01G290200 chr2D 634527341 634527925 584 False 998.000000 998 97.440000 1 585 1 chr2D.!!$F3 584
9 TraesCS5D01G290200 chr2D 617123832 617125617 1785 True 397.333333 536 94.349000 584 2643 3 chr2D.!!$R2 2059
10 TraesCS5D01G290200 chr1D 397126154 397126719 565 False 1018.000000 1018 99.117000 1 566 1 chr1D.!!$F1 565
11 TraesCS5D01G290200 chr7D 394196336 394196900 564 False 1016.000000 1016 99.115000 1 565 1 chr7D.!!$F2 564
12 TraesCS5D01G290200 chr7D 65841043 65841606 563 False 1014.000000 1014 99.113000 1 564 1 chr7D.!!$F1 563
13 TraesCS5D01G290200 chr4D 319283609 319284179 570 False 1016.000000 1016 98.774000 1 571 1 chr4D.!!$F2 570
14 TraesCS5D01G290200 chr4D 358702561 358703125 564 False 1016.000000 1016 99.115000 1 565 1 chr4D.!!$F3 564
15 TraesCS5D01G290200 chr2B 632381875 632382608 733 True 495.500000 527 91.801500 710 2650 2 chr2B.!!$R4 1940
16 TraesCS5D01G290200 chr2B 485757908 485759316 1408 False 351.500000 536 95.926500 584 1033 2 chr2B.!!$F2 449
17 TraesCS5D01G290200 chr6B 681260626 681262441 1815 True 388.333333 518 93.306000 584 2650 3 chr6B.!!$R1 2066

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
145 146 1.203063 TGGAGACACCTGTAGAGCACT 60.203 52.381 0.0 0.0 39.86 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1980 3045 2.046892 GAAAGGCAGCGCTCCTGA 60.047 61.111 23.41 0.0 44.64 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 5.244785 CTCATTAGTCACAATGCTTGCAT 57.755 39.130 1.81 1.81 36.13 3.96
97 98 8.328758 ACAATTGGAGTGACAAATCCTAATCTA 58.671 33.333 10.83 0.00 36.50 1.98
145 146 1.203063 TGGAGACACCTGTAGAGCACT 60.203 52.381 0.00 0.00 39.86 4.40
567 569 2.941480 AGGGCATATTTCCTTCAGCTG 58.059 47.619 7.63 7.63 0.00 4.24
676 678 8.178313 AGATCTTTCCGAAAACATTTTAACCT 57.822 30.769 0.00 0.00 0.00 3.50
912 1977 6.861065 AGGTAGTGTGTTGTGTTCTAATTG 57.139 37.500 0.00 0.00 0.00 2.32
1057 2122 1.252904 TTCGTGACCCGGGTAAGGAG 61.253 60.000 30.38 16.54 37.11 3.69
1228 2293 7.292713 TGTACCATCAACAGTTGTCTTACTA 57.707 36.000 13.14 0.00 0.00 1.82
1229 2294 7.149973 TGTACCATCAACAGTTGTCTTACTAC 58.850 38.462 13.14 7.22 0.00 2.73
1304 2369 3.897505 GCCTACTGAAATATTGGCCCATT 59.102 43.478 0.00 0.00 34.81 3.16
1760 2825 0.032615 TGGTCCAAGGTTTGCCTGTT 60.033 50.000 0.00 0.00 46.33 3.16
1966 3031 9.638239 CTATCTTTGTGCCTTGCTTTTATTTAA 57.362 29.630 0.00 0.00 0.00 1.52
2055 3122 3.252351 AGGCTTTTCCCTACAAGAGTCT 58.748 45.455 0.00 0.00 32.11 3.24
2136 3203 1.707427 ACTGGATCTTGGTGCCTTTCT 59.293 47.619 0.00 0.00 0.00 2.52
2227 5097 2.770164 AGAATCCTCACGGTGGAAAG 57.230 50.000 8.50 0.00 37.13 2.62
2231 5101 0.543410 TCCTCACGGTGGAAAGCCTA 60.543 55.000 8.50 0.00 34.31 3.93
2369 6885 3.304257 GCATCAGCATAATTCAGTTCCCG 60.304 47.826 0.00 0.00 41.58 5.14
2668 7185 3.512219 TGTACCCCTTTCATTCCGTTT 57.488 42.857 0.00 0.00 0.00 3.60
2785 7304 5.491982 ACTTGATCCATGTTCTGGTAAGTC 58.508 41.667 0.00 0.00 46.08 3.01
2841 7360 7.613022 AGATAGCAAAATCCATGAGTTTTGAGA 59.387 33.333 26.11 17.72 44.17 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 5.063204 GGTAATGCACATCACTATAAGCCA 58.937 41.667 0.00 0.00 0.00 4.75
97 98 2.279935 TGTTGGGTTGGCGTATTTCT 57.720 45.000 0.00 0.00 0.00 2.52
145 146 9.011095 TCACAACGTAAATGGGTGATTATAAAA 57.989 29.630 0.00 0.00 33.88 1.52
567 569 4.516698 CCATAACAGAGAGAGAGAGAGAGC 59.483 50.000 0.00 0.00 0.00 4.09
676 678 1.131303 ACCGAACCAAGGTGGATCCA 61.131 55.000 11.44 11.44 40.96 3.41
824 1889 6.578023 AGCACATAAGCCTAAAACAAAACAA 58.422 32.000 0.00 0.00 34.23 2.83
1228 2293 5.591067 TCTTTTTCGACAAACTGGGTAATGT 59.409 36.000 0.00 0.00 0.00 2.71
1229 2294 6.067263 TCTTTTTCGACAAACTGGGTAATG 57.933 37.500 0.00 0.00 0.00 1.90
1304 2369 2.859165 CCTCCTTGGTGCTGTTTCTA 57.141 50.000 0.00 0.00 0.00 2.10
1595 2660 4.044065 TGATATCCCAAACAGTCCTGGTTT 59.956 41.667 0.00 0.00 38.67 3.27
1760 2825 8.704668 TGGAGTGCTAGAACAATATCTAAATCA 58.295 33.333 3.00 0.00 31.76 2.57
1966 3031 3.865745 CGCTCCTGACAGTTTATCGAAAT 59.134 43.478 0.93 0.00 0.00 2.17
1980 3045 2.046892 GAAAGGCAGCGCTCCTGA 60.047 61.111 23.41 0.00 44.64 3.86
2136 3203 2.949177 TTCCAAACCTTAGCAGAGCA 57.051 45.000 0.00 0.00 0.00 4.26
2227 5097 9.034544 CAAAAATATTTACCAGAATTGCTAGGC 57.965 33.333 0.01 0.00 0.00 3.93
2231 5101 9.586435 GCTACAAAAATATTTACCAGAATTGCT 57.414 29.630 0.01 0.00 0.00 3.91
2268 5306 6.418057 TGGCATGGACAAAAGTTCTAAAAT 57.582 33.333 0.00 0.00 0.00 1.82
2668 7185 5.348259 ACTGAAGGGAAATAAAAAGGGGA 57.652 39.130 0.00 0.00 0.00 4.81
2785 7304 5.130292 AGCAAGAAACATCCAACATCTTG 57.870 39.130 8.95 8.95 46.07 3.02
2841 7360 6.603940 AATGGTTGTAAGCCATGTTTACAT 57.396 33.333 16.28 4.18 45.21 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.