Multiple sequence alignment - TraesCS5D01G272500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G272500 chr5D 100.000 3469 0 0 1 3469 375447393 375443925 0.000000e+00 6407
1 TraesCS5D01G272500 chr5D 92.887 2868 115 33 662 3469 449917471 449914633 0.000000e+00 4084
2 TraesCS5D01G272500 chr5D 98.193 664 11 1 1 663 526621441 526622104 0.000000e+00 1158
3 TraesCS5D01G272500 chr5D 95.633 664 25 2 1 663 449931919 449931259 0.000000e+00 1062
4 TraesCS5D01G272500 chr4D 97.296 2811 44 5 662 3469 477880477 477883258 0.000000e+00 4741
5 TraesCS5D01G272500 chr4D 97.003 2836 55 4 662 3469 433383006 433385839 0.000000e+00 4739
6 TraesCS5D01G272500 chr4D 98.193 664 11 1 1 663 433379843 433380506 0.000000e+00 1158
7 TraesCS5D01G272500 chr4D 97.888 663 7 2 2 663 477877154 477877810 0.000000e+00 1140
8 TraesCS5D01G272500 chr4D 90.715 657 59 2 6 661 108848672 108848017 0.000000e+00 874
9 TraesCS5D01G272500 chr4A 96.837 2814 81 4 662 3469 573674075 573671264 0.000000e+00 4697
10 TraesCS5D01G272500 chr4A 96.704 1942 54 6 1531 3469 608863238 608865172 0.000000e+00 3223
11 TraesCS5D01G272500 chr4A 98.494 664 9 1 1 663 608842158 608842821 0.000000e+00 1170
12 TraesCS5D01G272500 chr4A 98.810 168 2 0 662 829 608863076 608863243 2.020000e-77 300
13 TraesCS5D01G272500 chr3A 96.308 2817 81 7 662 3469 714634133 714631331 0.000000e+00 4604
14 TraesCS5D01G272500 chr4B 94.493 2306 107 11 662 2951 14628528 14630829 0.000000e+00 3537
15 TraesCS5D01G272500 chr4B 96.837 664 20 1 1 663 14625208 14625871 0.000000e+00 1109
16 TraesCS5D01G272500 chr5A 94.869 1598 74 5 1876 3469 396676974 396678567 0.000000e+00 2490
17 TraesCS5D01G272500 chr5A 96.536 664 22 1 1 663 396505106 396505769 0.000000e+00 1098
18 TraesCS5D01G272500 chr5A 89.039 739 53 7 662 1400 396617180 396617890 0.000000e+00 891
19 TraesCS5D01G272500 chr5A 81.412 425 31 12 1502 1879 396667823 396668246 1.560000e-78 303
20 TraesCS5D01G272500 chr5A 91.597 119 9 1 1398 1516 396631417 396631534 2.770000e-36 163
21 TraesCS5D01G272500 chr3D 93.853 1513 58 15 1961 3469 149761355 149759874 0.000000e+00 2246
22 TraesCS5D01G272500 chr3D 93.206 574 31 6 2898 3469 388413978 388413411 0.000000e+00 837
23 TraesCS5D01G272500 chr3D 91.720 157 13 0 1381 1537 149761506 149761350 5.830000e-53 219
24 TraesCS5D01G272500 chr2B 94.562 1324 52 9 2149 3469 685367142 685368448 0.000000e+00 2028
25 TraesCS5D01G272500 chr2B 96.539 1127 38 1 1027 2153 685356953 685358078 0.000000e+00 1864
26 TraesCS5D01G272500 chr2B 97.305 371 10 0 662 1032 685285779 685286149 6.320000e-177 630
27 TraesCS5D01G272500 chr7D 90.606 660 61 1 3 661 123495977 123496636 0.000000e+00 874


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G272500 chr5D 375443925 375447393 3468 True 6407.0 6407 100.0000 1 3469 1 chr5D.!!$R1 3468
1 TraesCS5D01G272500 chr5D 449914633 449917471 2838 True 4084.0 4084 92.8870 662 3469 1 chr5D.!!$R2 2807
2 TraesCS5D01G272500 chr5D 526621441 526622104 663 False 1158.0 1158 98.1930 1 663 1 chr5D.!!$F1 662
3 TraesCS5D01G272500 chr5D 449931259 449931919 660 True 1062.0 1062 95.6330 1 663 1 chr5D.!!$R3 662
4 TraesCS5D01G272500 chr4D 433379843 433385839 5996 False 2948.5 4739 97.5980 1 3469 2 chr4D.!!$F1 3468
5 TraesCS5D01G272500 chr4D 477877154 477883258 6104 False 2940.5 4741 97.5920 2 3469 2 chr4D.!!$F2 3467
6 TraesCS5D01G272500 chr4D 108848017 108848672 655 True 874.0 874 90.7150 6 661 1 chr4D.!!$R1 655
7 TraesCS5D01G272500 chr4A 573671264 573674075 2811 True 4697.0 4697 96.8370 662 3469 1 chr4A.!!$R1 2807
8 TraesCS5D01G272500 chr4A 608863076 608865172 2096 False 1761.5 3223 97.7570 662 3469 2 chr4A.!!$F2 2807
9 TraesCS5D01G272500 chr4A 608842158 608842821 663 False 1170.0 1170 98.4940 1 663 1 chr4A.!!$F1 662
10 TraesCS5D01G272500 chr3A 714631331 714634133 2802 True 4604.0 4604 96.3080 662 3469 1 chr3A.!!$R1 2807
11 TraesCS5D01G272500 chr4B 14625208 14630829 5621 False 2323.0 3537 95.6650 1 2951 2 chr4B.!!$F1 2950
12 TraesCS5D01G272500 chr5A 396676974 396678567 1593 False 2490.0 2490 94.8690 1876 3469 1 chr5A.!!$F5 1593
13 TraesCS5D01G272500 chr5A 396505106 396505769 663 False 1098.0 1098 96.5360 1 663 1 chr5A.!!$F1 662
14 TraesCS5D01G272500 chr5A 396617180 396617890 710 False 891.0 891 89.0390 662 1400 1 chr5A.!!$F2 738
15 TraesCS5D01G272500 chr3D 149759874 149761506 1632 True 1232.5 2246 92.7865 1381 3469 2 chr3D.!!$R2 2088
16 TraesCS5D01G272500 chr3D 388413411 388413978 567 True 837.0 837 93.2060 2898 3469 1 chr3D.!!$R1 571
17 TraesCS5D01G272500 chr2B 685367142 685368448 1306 False 2028.0 2028 94.5620 2149 3469 1 chr2B.!!$F3 1320
18 TraesCS5D01G272500 chr2B 685356953 685358078 1125 False 1864.0 1864 96.5390 1027 2153 1 chr2B.!!$F2 1126
19 TraesCS5D01G272500 chr7D 123495977 123496636 659 False 874.0 874 90.6060 3 661 1 chr7D.!!$F1 658

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
315 320 2.641815 AGCTTCCAGATCCACAAGAACT 59.358 45.455 0.0 0.0 0.00 3.01 F
1491 4176 0.448197 CAGAGCGTCTTCGTCTGCTA 59.552 55.000 0.0 0.0 37.91 3.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2272 5052 1.174783 GTCGTCCTCTTCCTGCACTA 58.825 55.000 0.0 0.0 0.0 2.74 R
3038 5864 1.625818 GTGATGGAGGAGTGAAGTGGT 59.374 52.381 0.0 0.0 0.0 4.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
260 265 2.907042 AGTGGTAGGAAGAGAAGGTTGG 59.093 50.000 0.00 0.0 0.00 3.77
315 320 2.641815 AGCTTCCAGATCCACAAGAACT 59.358 45.455 0.00 0.0 0.00 3.01
730 3404 5.121811 TGCTTGCTATGGATTTCTCTCTTC 58.878 41.667 0.00 0.0 0.00 2.87
861 3535 8.915036 CATGGTAGTTAATGTAGGTCTAGAAGT 58.085 37.037 0.00 0.0 0.00 3.01
969 3654 3.321111 TCGACCATTAGCCTATCCAACTC 59.679 47.826 0.00 0.0 0.00 3.01
1167 3852 2.438795 GACGAGGAGAGGGAGCGT 60.439 66.667 0.00 0.0 37.97 5.07
1255 3940 1.003233 GACCCTTTTCAGCGAGCCT 60.003 57.895 0.00 0.0 0.00 4.58
1491 4176 0.448197 CAGAGCGTCTTCGTCTGCTA 59.552 55.000 0.00 0.0 37.91 3.49
1744 4489 3.671008 TCACCACGCAATAACTACAGT 57.329 42.857 0.00 0.0 0.00 3.55
1993 4773 2.533916 TGCCATGCTATTTGGTTTGGA 58.466 42.857 0.00 0.0 36.57 3.53
2003 4783 2.746277 GGTTTGGAGCGCGGTGAT 60.746 61.111 18.92 0.0 0.00 3.06
2005 4785 2.813474 TTTGGAGCGCGGTGATCG 60.813 61.111 18.92 0.0 42.76 3.69
2272 5052 2.810274 CACAAGCTGCAACTGATGTAGT 59.190 45.455 1.02 0.0 43.07 2.73
2739 5547 2.371841 AGGTCAGTACTGGATGCAACAA 59.628 45.455 22.48 0.0 0.00 2.83
2819 5630 8.660435 ACTTACTATCCATACTTGGCATTACAT 58.340 33.333 0.00 0.0 43.29 2.29
2820 5631 8.846943 TTACTATCCATACTTGGCATTACATG 57.153 34.615 0.00 0.0 43.29 3.21
2997 5821 4.080356 TCAGATAACATAGCAAGGCCAGTT 60.080 41.667 5.01 0.0 0.00 3.16
2998 5822 5.130311 TCAGATAACATAGCAAGGCCAGTTA 59.870 40.000 5.01 0.0 0.00 2.24
3038 5864 9.634021 CTCATATATACTTACCATCCAGAGCTA 57.366 37.037 0.00 0.0 0.00 3.32
3350 6177 1.180029 GGCTTGTGCAATCCATGTCT 58.820 50.000 0.00 0.0 41.91 3.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 4.339247 AGCCTGTATGTAATTCCACATTGC 59.661 41.667 0.00 0.0 39.77 3.56
260 265 5.104318 ACCATACCCTTTCCTTCATCTTCTC 60.104 44.000 0.00 0.0 0.00 2.87
315 320 3.290948 AGCACAGTCCCTTACAAAACA 57.709 42.857 0.00 0.0 0.00 2.83
730 3404 7.924412 AGAATTCATACAAGCTGGCATTTATTG 59.076 33.333 8.44 0.0 0.00 1.90
1113 3798 3.044305 GCGAGCGCTTGGTTCTGT 61.044 61.111 25.74 0.0 38.26 3.41
1167 3852 1.267574 GGTGATGGAGGTCAGGCAGA 61.268 60.000 0.00 0.0 0.00 4.26
1491 4176 2.159226 GCAGCATCCTCAGTACTAACGT 60.159 50.000 0.00 0.0 0.00 3.99
1744 4489 4.038763 CAGTGAGACTTGGTGGTAGTTGTA 59.961 45.833 0.00 0.0 0.00 2.41
1993 4773 4.286320 GATCCCGATCACCGCGCT 62.286 66.667 5.56 0.0 37.74 5.92
2272 5052 1.174783 GTCGTCCTCTTCCTGCACTA 58.825 55.000 0.00 0.0 0.00 2.74
2396 5179 3.618351 CTTGATCTGCCTTGGATCTGTT 58.382 45.455 0.00 0.0 39.95 3.16
2588 5371 6.470557 GCACATACATGCAAATCAAGTTTT 57.529 33.333 0.00 0.0 45.39 2.43
2819 5630 3.788227 AACTGCCTATGAACTCCAACA 57.212 42.857 0.00 0.0 0.00 3.33
2820 5631 7.934120 AGATATTAACTGCCTATGAACTCCAAC 59.066 37.037 0.00 0.0 0.00 3.77
3038 5864 1.625818 GTGATGGAGGAGTGAAGTGGT 59.374 52.381 0.00 0.0 0.00 4.16
3297 6124 3.694043 ACTGAAGGAGAAGAAGAAGCC 57.306 47.619 0.00 0.0 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.