Multiple sequence alignment - TraesCS5D01G272000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G272000 chr5D 100.000 2493 0 0 1 2493 375355916 375358408 0 4604
1 TraesCS5D01G272000 chr5D 98.366 2509 20 6 1 2493 335823516 335826019 0 4386
2 TraesCS5D01G272000 chr5D 98.286 2509 21 7 1 2493 55023989 55021487 0 4375
3 TraesCS5D01G272000 chr5D 98.295 1642 8 5 867 2493 442642103 442643739 0 2859
4 TraesCS5D01G272000 chr7D 98.406 2509 17 8 1 2493 567322007 567324508 0 4390
5 TraesCS5D01G272000 chr7D 98.049 2511 26 8 1 2493 589613502 589610997 0 4344
6 TraesCS5D01G272000 chr7D 98.297 1233 5 2 1276 2493 17735723 17736954 0 2146
7 TraesCS5D01G272000 chr3D 98.365 2508 21 5 1 2493 68827254 68824752 0 4386
8 TraesCS5D01G272000 chr1D 98.246 2508 25 4 1 2493 203582857 203585360 0 4370
9 TraesCS5D01G272000 chr1D 98.087 2509 20 5 1 2493 143269191 143266695 0 4342
10 TraesCS5D01G272000 chr1D 98.046 2508 26 6 1 2493 19993785 19991286 0 4338
11 TraesCS5D01G272000 chr1D 98.228 1693 11 4 817 2493 49896494 49898183 0 2942
12 TraesCS5D01G272000 chr1D 98.417 1642 9 3 867 2493 58905403 58903764 0 2872
13 TraesCS5D01G272000 chr4D 98.046 2508 28 4 1 2493 433308248 433305747 0 4340
14 TraesCS5D01G272000 chr6D 98.147 1889 19 2 1 1874 459305431 459303544 0 3280


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G272000 chr5D 375355916 375358408 2492 False 4604 4604 100.000 1 2493 1 chr5D.!!$F2 2492
1 TraesCS5D01G272000 chr5D 335823516 335826019 2503 False 4386 4386 98.366 1 2493 1 chr5D.!!$F1 2492
2 TraesCS5D01G272000 chr5D 55021487 55023989 2502 True 4375 4375 98.286 1 2493 1 chr5D.!!$R1 2492
3 TraesCS5D01G272000 chr5D 442642103 442643739 1636 False 2859 2859 98.295 867 2493 1 chr5D.!!$F3 1626
4 TraesCS5D01G272000 chr7D 567322007 567324508 2501 False 4390 4390 98.406 1 2493 1 chr7D.!!$F2 2492
5 TraesCS5D01G272000 chr7D 589610997 589613502 2505 True 4344 4344 98.049 1 2493 1 chr7D.!!$R1 2492
6 TraesCS5D01G272000 chr7D 17735723 17736954 1231 False 2146 2146 98.297 1276 2493 1 chr7D.!!$F1 1217
7 TraesCS5D01G272000 chr3D 68824752 68827254 2502 True 4386 4386 98.365 1 2493 1 chr3D.!!$R1 2492
8 TraesCS5D01G272000 chr1D 203582857 203585360 2503 False 4370 4370 98.246 1 2493 1 chr1D.!!$F2 2492
9 TraesCS5D01G272000 chr1D 143266695 143269191 2496 True 4342 4342 98.087 1 2493 1 chr1D.!!$R3 2492
10 TraesCS5D01G272000 chr1D 19991286 19993785 2499 True 4338 4338 98.046 1 2493 1 chr1D.!!$R1 2492
11 TraesCS5D01G272000 chr1D 49896494 49898183 1689 False 2942 2942 98.228 817 2493 1 chr1D.!!$F1 1676
12 TraesCS5D01G272000 chr1D 58903764 58905403 1639 True 2872 2872 98.417 867 2493 1 chr1D.!!$R2 1626
13 TraesCS5D01G272000 chr4D 433305747 433308248 2501 True 4340 4340 98.046 1 2493 1 chr4D.!!$R1 2492
14 TraesCS5D01G272000 chr6D 459303544 459305431 1887 True 3280 3280 98.147 1 1874 1 chr6D.!!$R1 1873

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
575 591 1.156736 CAAACACCACCCGTCAGATC 58.843 55.0 0.0 0.0 0.0 2.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1566 1585 3.854666 ACATTCAGAGATCGACAGTTGG 58.145 45.455 0.0 0.0 0.0 3.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
575 591 1.156736 CAAACACCACCCGTCAGATC 58.843 55.000 0.0 0.0 0.00 2.75
865 882 3.004171 CTCGTTCTTCTTCCTCTCGAGA 58.996 50.000 15.7 15.7 43.53 4.04
1435 1454 5.771666 TGAGTTGAAGAAGCAATCCAATCTT 59.228 36.000 0.0 0.0 34.96 2.40
1566 1585 6.545504 TCTCAAATGCAACTCTGTTTAGTC 57.454 37.500 0.0 0.0 0.00 2.59
1915 1950 2.568623 AGGAACGATTGCTTTGTCCT 57.431 45.000 0.0 0.0 0.00 3.85
2185 2223 6.072112 TGACTAAAGCCAAACATCTCAAAC 57.928 37.500 0.0 0.0 0.00 2.93
2482 2520 7.225734 AGGGCAACAAACATAACAAAACATTAC 59.774 33.333 0.0 0.0 39.74 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
459 475 2.240414 CGGGGTTATTAGGGTTTGACCT 59.760 50.000 0.0 0.0 44.75 3.85
865 882 4.814967 TGGGGAAAGAAACAGAGGAATTT 58.185 39.130 0.0 0.0 0.00 1.82
1189 1208 2.513753 TGGTGGCATTTCTTCACGATT 58.486 42.857 0.0 0.0 32.65 3.34
1435 1454 9.026121 CCTAGAGCAAGTATTCCTAAAGCTATA 57.974 37.037 0.0 0.0 0.00 1.31
1566 1585 3.854666 ACATTCAGAGATCGACAGTTGG 58.145 45.455 0.0 0.0 0.00 3.77
1887 1921 6.814146 ACAAAGCAATCGTTCCTAAACAAAAA 59.186 30.769 0.0 0.0 34.93 1.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.