Multiple sequence alignment - TraesCS5D01G271300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G271300 chr5D 100.000 2627 0 0 1 2627 375001992 375004618 0.000000e+00 4852
1 TraesCS5D01G271300 chr5D 96.624 2636 76 7 1 2627 184453025 184455656 0.000000e+00 4362
2 TraesCS5D01G271300 chr5D 95.609 2505 104 5 1 2505 397473180 397470682 0.000000e+00 4012
3 TraesCS5D01G271300 chr5D 95.128 2504 115 5 2 2505 397466574 397469070 0.000000e+00 3941
4 TraesCS5D01G271300 chr3A 95.577 2487 99 8 144 2627 117786785 117784307 0.000000e+00 3973
5 TraesCS5D01G271300 chr3A 95.253 2507 107 8 123 2627 720600566 720598070 0.000000e+00 3960
6 TraesCS5D01G271300 chr3A 93.309 1644 96 4 985 2627 315887383 315885753 0.000000e+00 2414
7 TraesCS5D01G271300 chr3A 96.396 111 4 0 2517 2627 622462004 622462114 1.610000e-42 183
8 TraesCS5D01G271300 chr6B 93.767 2631 158 6 1 2627 666360968 666358340 0.000000e+00 3945
9 TraesCS5D01G271300 chr4A 94.453 2506 130 7 123 2627 444377901 444380398 0.000000e+00 3849
10 TraesCS5D01G271300 chr7A 96.990 2093 58 3 1 2093 692229366 692231453 0.000000e+00 3511
11 TraesCS5D01G271300 chr2A 95.987 1794 71 1 1 1794 33472829 33471037 0.000000e+00 2913
12 TraesCS5D01G271300 chr2A 93.540 805 46 5 1824 2627 33471044 33470245 0.000000e+00 1194
13 TraesCS5D01G271300 chr2A 91.451 503 36 5 2130 2627 478457240 478457740 0.000000e+00 684


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G271300 chr5D 375001992 375004618 2626 False 4852.0 4852 100.0000 1 2627 1 chr5D.!!$F2 2626
1 TraesCS5D01G271300 chr5D 184453025 184455656 2631 False 4362.0 4362 96.6240 1 2627 1 chr5D.!!$F1 2626
2 TraesCS5D01G271300 chr5D 397470682 397473180 2498 True 4012.0 4012 95.6090 1 2505 1 chr5D.!!$R1 2504
3 TraesCS5D01G271300 chr5D 397466574 397469070 2496 False 3941.0 3941 95.1280 2 2505 1 chr5D.!!$F3 2503
4 TraesCS5D01G271300 chr3A 117784307 117786785 2478 True 3973.0 3973 95.5770 144 2627 1 chr3A.!!$R1 2483
5 TraesCS5D01G271300 chr3A 720598070 720600566 2496 True 3960.0 3960 95.2530 123 2627 1 chr3A.!!$R3 2504
6 TraesCS5D01G271300 chr3A 315885753 315887383 1630 True 2414.0 2414 93.3090 985 2627 1 chr3A.!!$R2 1642
7 TraesCS5D01G271300 chr6B 666358340 666360968 2628 True 3945.0 3945 93.7670 1 2627 1 chr6B.!!$R1 2626
8 TraesCS5D01G271300 chr4A 444377901 444380398 2497 False 3849.0 3849 94.4530 123 2627 1 chr4A.!!$F1 2504
9 TraesCS5D01G271300 chr7A 692229366 692231453 2087 False 3511.0 3511 96.9900 1 2093 1 chr7A.!!$F1 2092
10 TraesCS5D01G271300 chr2A 33470245 33472829 2584 True 2053.5 2913 94.7635 1 2627 2 chr2A.!!$R1 2626
11 TraesCS5D01G271300 chr2A 478457240 478457740 500 False 684.0 684 91.4510 2130 2627 1 chr2A.!!$F1 497

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
698 702 1.707989 TGCCTGGGTTTGTGGATCTTA 59.292 47.619 0.0 0.0 0.0 2.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1927 1972 1.446907 GCAGACCATCACACAGAAGG 58.553 55.0 0.0 0.0 40.94 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
436 437 7.714703 TGATAGATAGCTGTCTCATATGCATC 58.285 38.462 17.10 12.28 33.80 3.91
638 642 5.545658 ACCTGATTGTAAACATAACTGCG 57.454 39.130 0.00 0.00 0.00 5.18
698 702 1.707989 TGCCTGGGTTTGTGGATCTTA 59.292 47.619 0.00 0.00 0.00 2.10
929 933 8.635328 TCGAGCAGTGGTACTGATTATATAAAA 58.365 33.333 12.79 0.00 45.93 1.52
1022 1026 2.125269 GGAATACCACGCCGCAGT 60.125 61.111 0.00 0.00 35.97 4.40
1485 1490 5.679355 CGCTACTTTTGTTGTTGAAATCGAA 59.321 36.000 0.00 0.00 0.00 3.71
1494 1499 5.240623 TGTTGTTGAAATCGAAATGCTACCT 59.759 36.000 0.00 0.00 0.00 3.08
1495 1500 5.545658 TGTTGAAATCGAAATGCTACCTC 57.454 39.130 0.00 0.00 0.00 3.85
1530 1535 6.621380 GCTGTCTGTCAATCGAATCAAATTGA 60.621 38.462 0.00 0.00 39.06 2.57
1716 1721 1.611491 GAGTCGGCTCCATCTTCTAGG 59.389 57.143 5.50 0.00 35.76 3.02
1717 1722 1.063567 AGTCGGCTCCATCTTCTAGGT 60.064 52.381 0.00 0.00 0.00 3.08
2035 2080 0.532573 CTCTGGTGCGAGGAAAGCTA 59.467 55.000 0.00 0.00 35.28 3.32
2074 2119 1.950484 GCCTACTTGCTTGGCTGCTAA 60.950 52.381 0.00 0.00 43.05 3.09
2212 2257 4.100498 TGTTATCTAAACCCGGGAGATGTC 59.900 45.833 32.02 20.08 32.27 3.06
2518 2580 2.112815 GGAAGTATGGCCCGTGCAC 61.113 63.158 6.82 6.82 40.13 4.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
217 218 6.932400 ACAAAATACACAGGATAAACTCGTCA 59.068 34.615 0.00 0.00 0.00 4.35
436 437 2.403252 AGCACCATTAGGAACGGAAG 57.597 50.000 0.00 0.00 38.69 3.46
929 933 9.331282 GAGTGAAGCTACCAAGACAATATAAAT 57.669 33.333 0.00 0.00 0.00 1.40
1485 1490 1.142465 CAGCAGGATGGAGGTAGCATT 59.858 52.381 0.00 0.00 35.86 3.56
1494 1499 1.196766 ACAGACAGCAGCAGGATGGA 61.197 55.000 0.00 0.00 37.17 3.41
1495 1500 0.743701 GACAGACAGCAGCAGGATGG 60.744 60.000 0.00 0.00 37.17 3.51
1530 1535 4.401022 TGCAAACTCATTCATTCTCTGGT 58.599 39.130 0.00 0.00 0.00 4.00
1680 1685 1.615883 GACTCACCAGAGAGCTTGTGA 59.384 52.381 0.00 0.00 44.98 3.58
1716 1721 4.502431 GGAGCAGAAAATAGGGAGCTAGAC 60.502 50.000 0.00 0.00 31.61 2.59
1717 1722 3.643792 GGAGCAGAAAATAGGGAGCTAGA 59.356 47.826 0.00 0.00 31.61 2.43
1927 1972 1.446907 GCAGACCATCACACAGAAGG 58.553 55.000 0.00 0.00 40.94 3.46
2035 2080 2.479730 GGCATCGTTGACGTCTACTCAT 60.480 50.000 24.04 14.64 40.80 2.90
2074 2119 3.511595 CCGGCGCATGCATCACTT 61.512 61.111 19.57 0.00 45.35 3.16
2212 2257 9.614792 ATCATCCATCATATCACATCACATAAG 57.385 33.333 0.00 0.00 0.00 1.73
2361 2407 7.658575 GCCCAATTAGTTGTTCGGTATTAGATA 59.341 37.037 0.00 0.00 33.36 1.98
2371 2417 4.497473 TTTCAGCCCAATTAGTTGTTCG 57.503 40.909 0.00 0.00 33.36 3.95
2373 2419 5.610398 CCTTTTTCAGCCCAATTAGTTGTT 58.390 37.500 0.00 0.00 33.36 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.