Multiple sequence alignment - TraesCS5D01G257500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G257500 chr5D 100.000 2288 0 0 1 2288 363977374 363975087 0.000000e+00 4226.0
1 TraesCS5D01G257500 chr5D 96.398 1777 23 16 531 2288 363340809 363339055 0.000000e+00 2889.0
2 TraesCS5D01G257500 chr5D 95.624 1074 21 11 560 1624 363178524 363177468 0.000000e+00 1700.0
3 TraesCS5D01G257500 chr5D 95.764 661 23 4 1628 2288 363177357 363176702 0.000000e+00 1061.0
4 TraesCS5D01G257500 chr5D 83.851 161 22 4 1 161 267821553 267821709 1.420000e-32 150.0
5 TraesCS5D01G257500 chr5A 94.714 1627 69 14 2 1624 464635917 464634304 0.000000e+00 2512.0
6 TraesCS5D01G257500 chr5A 97.428 661 16 1 1628 2288 464634232 464633573 0.000000e+00 1125.0
7 TraesCS5D01G257500 chr5A 87.586 145 17 1 1 145 355160477 355160620 1.410000e-37 167.0
8 TraesCS5D01G257500 chr5B 94.247 1634 78 14 1 1624 429821760 429820133 0.000000e+00 2483.0
9 TraesCS5D01G257500 chr5B 93.882 850 22 13 786 1625 429727948 429727119 0.000000e+00 1254.0
10 TraesCS5D01G257500 chr5B 95.613 661 24 2 1628 2288 429727042 429726387 0.000000e+00 1055.0
11 TraesCS5D01G257500 chr5B 95.461 661 24 3 1628 2288 429820061 429819407 0.000000e+00 1050.0
12 TraesCS5D01G257500 chr5B 97.239 507 14 0 864 1370 429883657 429883151 0.000000e+00 859.0
13 TraesCS5D01G257500 chr5B 88.133 632 59 11 1628 2256 429882823 429882205 0.000000e+00 737.0
14 TraesCS5D01G257500 chr5B 85.470 351 34 11 476 818 429884367 429884026 1.300000e-92 350.0
15 TraesCS5D01G257500 chr5B 92.683 164 7 1 1401 1559 429883154 429882991 4.920000e-57 231.0
16 TraesCS5D01G257500 chr5B 84.472 161 19 6 1 161 302843278 302843432 1.090000e-33 154.0
17 TraesCS5D01G257500 chr5B 80.392 102 15 4 162 263 603691592 603691496 3.150000e-09 73.1
18 TraesCS5D01G257500 chr6B 82.700 474 80 2 881 1353 179464594 179464122 9.770000e-114 420.0
19 TraesCS5D01G257500 chr7A 86.957 161 19 2 1 161 297943014 297943172 1.810000e-41 180.0
20 TraesCS5D01G257500 chrUn 77.632 304 57 11 1058 1355 22056440 22056738 8.400000e-40 174.0
21 TraesCS5D01G257500 chr2D 77.181 298 60 8 1058 1351 474749987 474750280 1.410000e-37 167.0
22 TraesCS5D01G257500 chr7D 85.000 160 22 2 2 161 269717384 269717227 6.540000e-36 161.0
23 TraesCS5D01G257500 chr7D 82.051 78 9 4 189 266 32649223 32649295 6.820000e-06 62.1
24 TraesCS5D01G257500 chr3B 84.472 161 23 2 1 161 559885508 559885350 8.460000e-35 158.0
25 TraesCS5D01G257500 chr7B 83.125 160 25 2 2 161 271316183 271316026 6.590000e-31 145.0
26 TraesCS5D01G257500 chr7B 86.567 67 5 3 267 332 674108728 674108791 1.130000e-08 71.3
27 TraesCS5D01G257500 chr7B 86.567 67 5 3 267 332 674110180 674110243 1.130000e-08 71.3
28 TraesCS5D01G257500 chr7B 85.075 67 6 3 267 332 674110664 674110727 5.280000e-07 65.8
29 TraesCS5D01G257500 chr1D 82.524 103 14 3 162 264 53956880 53956782 1.130000e-13 87.9
30 TraesCS5D01G257500 chr3D 82.609 92 13 3 173 263 384867149 384867238 6.780000e-11 78.7
31 TraesCS5D01G257500 chr4B 83.333 78 12 1 187 263 576168162 576168085 1.130000e-08 71.3
32 TraesCS5D01G257500 chr2B 80.000 100 13 6 167 263 568278270 568278365 1.470000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G257500 chr5D 363975087 363977374 2287 True 4226.00 4226 100.00000 1 2288 1 chr5D.!!$R2 2287
1 TraesCS5D01G257500 chr5D 363339055 363340809 1754 True 2889.00 2889 96.39800 531 2288 1 chr5D.!!$R1 1757
2 TraesCS5D01G257500 chr5D 363176702 363178524 1822 True 1380.50 1700 95.69400 560 2288 2 chr5D.!!$R3 1728
3 TraesCS5D01G257500 chr5A 464633573 464635917 2344 True 1818.50 2512 96.07100 2 2288 2 chr5A.!!$R1 2286
4 TraesCS5D01G257500 chr5B 429819407 429821760 2353 True 1766.50 2483 94.85400 1 2288 2 chr5B.!!$R3 2287
5 TraesCS5D01G257500 chr5B 429726387 429727948 1561 True 1154.50 1254 94.74750 786 2288 2 chr5B.!!$R2 1502
6 TraesCS5D01G257500 chr5B 429882205 429884367 2162 True 544.25 859 90.88125 476 2256 4 chr5B.!!$R4 1780

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
105 106 0.393132 TTCCAGTGACACACGGCAAA 60.393 50.0 8.59 0.0 39.64 3.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1713 2251 0.247736 CTGGACGCTCTAGCAGGTTT 59.752 55.0 2.44 0.0 42.21 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 2.029380 TGATAAGTGTCACACGTCAGGG 60.029 50.000 0.00 0.00 39.64 4.45
27 28 3.936203 TGTCACACGTCAGGGGCC 61.936 66.667 0.00 0.00 0.00 5.80
53 54 2.143925 CTCTGGTCCTGACGTTTTTCC 58.856 52.381 0.00 0.00 0.00 3.13
54 55 1.766496 TCTGGTCCTGACGTTTTTCCT 59.234 47.619 0.00 0.00 0.00 3.36
55 56 2.967201 TCTGGTCCTGACGTTTTTCCTA 59.033 45.455 0.00 0.00 0.00 2.94
56 57 3.581332 TCTGGTCCTGACGTTTTTCCTAT 59.419 43.478 0.00 0.00 0.00 2.57
58 59 5.080969 TGGTCCTGACGTTTTTCCTATAG 57.919 43.478 0.00 0.00 0.00 1.31
105 106 0.393132 TTCCAGTGACACACGGCAAA 60.393 50.000 8.59 0.00 39.64 3.68
145 149 7.556733 AAACTAAACCACGAAAGTTGTCATA 57.443 32.000 0.00 0.00 46.40 2.15
151 155 3.364964 CCACGAAAGTTGTCATACTTGCC 60.365 47.826 0.00 0.00 46.40 4.52
153 157 3.498397 ACGAAAGTTGTCATACTTGCCAG 59.502 43.478 0.00 0.00 46.40 4.85
369 375 7.427989 TCTTATATTTGTTAACGGAGGGAGT 57.572 36.000 0.26 0.00 0.00 3.85
387 393 3.194861 GAGTGCATAATTACTGCCGTCA 58.805 45.455 13.70 0.00 38.89 4.35
429 435 8.694394 GCAATTGTGATCTCTTTGAAAGTTAAC 58.306 33.333 7.40 0.00 0.00 2.01
545 551 8.603304 ACCAAAGGTGATATTACTTACAGAAGT 58.397 33.333 0.00 0.00 41.10 3.01
621 638 2.196595 TGCAGATATACCCCCATAGGC 58.803 52.381 0.00 0.00 0.00 3.93
767 799 1.429148 GGGTCGCGATCATGTCCAAC 61.429 60.000 22.78 0.00 0.00 3.77
802 837 2.455674 ACGATAGCAACAGCAACAGA 57.544 45.000 0.00 0.00 42.67 3.41
838 1187 2.411748 ACTGTGCATGTATTCGAACGTG 59.588 45.455 0.00 2.10 39.03 4.49
1383 1747 9.139174 CAAAGGATGCGTTGATTAACTAAAATT 57.861 29.630 7.07 0.00 34.60 1.82
1713 2251 2.287368 CGAGCATGTATACGGCTGTACA 60.287 50.000 22.11 5.55 38.15 2.90
1810 2348 1.449601 CATAACCGTTGAGGCCGCT 60.450 57.895 8.34 0.00 46.52 5.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 1.915769 AGGACCAGAGTGTCAGGCC 60.916 63.158 0.00 0.00 36.97 5.19
27 28 0.242286 CGTCAGGACCAGAGTGTCAG 59.758 60.000 0.00 0.00 36.97 3.51
53 54 5.469373 TTGCGTGACTGAAATTGCTATAG 57.531 39.130 0.00 0.00 0.00 1.31
54 55 4.332543 CCTTGCGTGACTGAAATTGCTATA 59.667 41.667 0.00 0.00 0.00 1.31
55 56 3.127548 CCTTGCGTGACTGAAATTGCTAT 59.872 43.478 0.00 0.00 0.00 2.97
56 57 2.483877 CCTTGCGTGACTGAAATTGCTA 59.516 45.455 0.00 0.00 0.00 3.49
58 59 1.266718 TCCTTGCGTGACTGAAATTGC 59.733 47.619 0.00 0.00 0.00 3.56
145 149 1.202855 ACATCACTTCAGCTGGCAAGT 60.203 47.619 15.13 14.21 32.87 3.16
151 155 6.992063 AAGGTTATAACATCACTTCAGCTG 57.008 37.500 17.16 7.63 0.00 4.24
153 157 8.515414 AGAAAAAGGTTATAACATCACTTCAGC 58.485 33.333 17.16 4.75 0.00 4.26
265 270 7.771183 TGCTCAACAGAAAGATAACAAAGTTT 58.229 30.769 0.00 0.00 0.00 2.66
369 375 3.738791 CGTATGACGGCAGTAATTATGCA 59.261 43.478 16.51 0.00 45.68 3.96
387 393 5.007682 ACAATTGCCAAAGAAGTACCGTAT 58.992 37.500 5.05 0.00 0.00 3.06
444 450 8.081633 CCACAACAGAATTGCACTAAAAGATTA 58.918 33.333 0.00 0.00 0.00 1.75
564 578 8.464770 TTTCAGCCAAAATTTGATCTAAATCG 57.535 30.769 7.37 0.00 38.01 3.34
802 837 2.480073 GCACAGTGCTGTTGATTGTTGT 60.480 45.455 18.92 0.00 42.83 3.32
1383 1747 6.035975 TCGTGAACGAACGTACTCTATCAATA 59.964 38.462 2.48 0.00 46.30 1.90
1713 2251 0.247736 CTGGACGCTCTAGCAGGTTT 59.752 55.000 2.44 0.00 42.21 3.27
2254 2792 3.407967 ATACCACCACCCGGCCAG 61.408 66.667 2.24 0.00 34.57 4.85
2255 2793 3.722813 CATACCACCACCCGGCCA 61.723 66.667 2.24 0.00 34.57 5.36
2256 2794 4.499633 CCATACCACCACCCGGCC 62.500 72.222 0.00 0.00 34.57 6.13
2259 2797 0.678684 GAAACCCATACCACCACCCG 60.679 60.000 0.00 0.00 0.00 5.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.