Multiple sequence alignment - TraesCS5D01G255000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G255000 chr5D 100.000 2151 0 0 939 3089 361414005 361411855 0 3973
1 TraesCS5D01G255000 chr5D 98.995 1094 9 2 1996 3089 354711841 354710750 0 1958
2 TraesCS5D01G255000 chr5D 98.812 1094 12 1 1996 3089 486200344 486201436 0 1947
3 TraesCS5D01G255000 chr5D 100.000 445 0 0 1 445 361414943 361414499 0 822
4 TraesCS5D01G255000 chr5D 96.854 445 11 3 1 445 29020770 29020329 0 741
5 TraesCS5D01G255000 chr3D 98.903 1094 12 0 1996 3089 557716708 557715615 0 1954
6 TraesCS5D01G255000 chr3D 98.903 1094 11 1 1996 3089 564995951 564997043 0 1953
7 TraesCS5D01G255000 chr3D 98.839 1034 9 2 965 1995 86231023 86232056 0 1840
8 TraesCS5D01G255000 chr3D 98.261 1035 14 3 965 1995 99815758 99816792 0 1808
9 TraesCS5D01G255000 chr3D 97.216 431 10 2 1 431 123375572 123375144 0 728
10 TraesCS5D01G255000 chr7D 98.903 1094 11 1 1996 3089 517330487 517331579 0 1953
11 TraesCS5D01G255000 chr7D 98.185 1047 14 4 965 2007 598442408 598443453 0 1823
12 TraesCS5D01G255000 chr7D 97.303 445 10 2 1 445 82914745 82914303 0 754
13 TraesCS5D01G255000 chr7D 96.840 443 12 2 1 443 598440581 598441021 0 739
14 TraesCS5D01G255000 chr7D 97.222 432 9 3 1 432 64455659 64456087 0 728
15 TraesCS5D01G255000 chr2D 98.903 1094 11 1 1996 3089 396655614 396656706 0 1953
16 TraesCS5D01G255000 chr2D 98.646 1034 11 2 965 1995 396654547 396655580 0 1829
17 TraesCS5D01G255000 chr2D 98.453 1034 12 3 965 1995 35040997 35042029 0 1818
18 TraesCS5D01G255000 chr2D 98.090 1047 15 4 965 2007 575236568 575235523 0 1818
19 TraesCS5D01G255000 chr2D 97.753 445 9 1 1 445 573467771 573468214 0 765
20 TraesCS5D01G255000 chr2D 97.079 445 11 2 1 445 10437647 10438089 0 749
21 TraesCS5D01G255000 chr2D 95.955 445 15 3 1 445 33991726 33992167 0 719
22 TraesCS5D01G255000 chr1D 98.812 1094 12 1 1996 3089 50069869 50068777 0 1947
23 TraesCS5D01G255000 chr1D 98.812 1094 12 1 1996 3089 467393715 467394807 0 1947
24 TraesCS5D01G255000 chr1D 98.549 1034 12 2 965 1995 342837848 342838881 0 1823
25 TraesCS5D01G255000 chr1D 97.994 1047 15 5 965 2007 50070935 50069891 0 1812
26 TraesCS5D01G255000 chr4D 98.723 1096 11 2 1996 3089 67450129 67451223 0 1943
27 TraesCS5D01G255000 chrUn 98.281 1047 13 4 965 2007 378302152 378301107 0 1829
28 TraesCS5D01G255000 chr6D 97.309 446 9 3 1 445 90428472 90428915 0 754


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G255000 chr5D 361411855 361414943 3088 True 2397.5 3973 100.0000 1 3089 2 chr5D.!!$R3 3088
1 TraesCS5D01G255000 chr5D 354710750 354711841 1091 True 1958.0 1958 98.9950 1996 3089 1 chr5D.!!$R2 1093
2 TraesCS5D01G255000 chr5D 486200344 486201436 1092 False 1947.0 1947 98.8120 1996 3089 1 chr5D.!!$F1 1093
3 TraesCS5D01G255000 chr3D 557715615 557716708 1093 True 1954.0 1954 98.9030 1996 3089 1 chr3D.!!$R2 1093
4 TraesCS5D01G255000 chr3D 564995951 564997043 1092 False 1953.0 1953 98.9030 1996 3089 1 chr3D.!!$F3 1093
5 TraesCS5D01G255000 chr3D 86231023 86232056 1033 False 1840.0 1840 98.8390 965 1995 1 chr3D.!!$F1 1030
6 TraesCS5D01G255000 chr3D 99815758 99816792 1034 False 1808.0 1808 98.2610 965 1995 1 chr3D.!!$F2 1030
7 TraesCS5D01G255000 chr7D 517330487 517331579 1092 False 1953.0 1953 98.9030 1996 3089 1 chr7D.!!$F2 1093
8 TraesCS5D01G255000 chr7D 598440581 598443453 2872 False 1281.0 1823 97.5125 1 2007 2 chr7D.!!$F3 2006
9 TraesCS5D01G255000 chr2D 396654547 396656706 2159 False 1891.0 1953 98.7745 965 3089 2 chr2D.!!$F5 2124
10 TraesCS5D01G255000 chr2D 35040997 35042029 1032 False 1818.0 1818 98.4530 965 1995 1 chr2D.!!$F3 1030
11 TraesCS5D01G255000 chr2D 575235523 575236568 1045 True 1818.0 1818 98.0900 965 2007 1 chr2D.!!$R1 1042
12 TraesCS5D01G255000 chr1D 467393715 467394807 1092 False 1947.0 1947 98.8120 1996 3089 1 chr1D.!!$F2 1093
13 TraesCS5D01G255000 chr1D 50068777 50070935 2158 True 1879.5 1947 98.4030 965 3089 2 chr1D.!!$R1 2124
14 TraesCS5D01G255000 chr1D 342837848 342838881 1033 False 1823.0 1823 98.5490 965 1995 1 chr1D.!!$F1 1030
15 TraesCS5D01G255000 chr4D 67450129 67451223 1094 False 1943.0 1943 98.7230 1996 3089 1 chr4D.!!$F1 1093
16 TraesCS5D01G255000 chrUn 378301107 378302152 1045 True 1829.0 1829 98.2810 965 2007 1 chrUn.!!$R1 1042

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
252 253 0.497265 GTCGGTACAAATCGCGATCG 59.503 55.000 23.92 19.66 0.0 3.69 F
287 288 1.444895 GCCGCAAAAGCACCAGATG 60.445 57.895 0.00 0.00 0.0 2.90 F
1626 2495 2.029290 GGAGGTGAACGCTCTCAAAGTA 60.029 50.000 0.00 0.00 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1626 2495 0.463654 TGTTCTGTTGAGGCTTGCGT 60.464 50.000 0.0 0.0 0.00 5.24 R
1644 2513 4.115199 CCCTTCCGGCCCCTCTTG 62.115 72.222 0.0 0.0 0.00 3.02 R
2519 3425 1.202020 CGGGTACAACAACGCATCATG 60.202 52.381 0.0 0.0 32.86 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 4.583907 CCCCACTTTTTGCAAAAATGGATT 59.416 37.500 36.31 21.41 37.99 3.01
81 82 5.007034 TGCAAAAATGGATTCCTCTCGTTA 58.993 37.500 3.95 0.00 0.00 3.18
154 155 0.811281 GTGCGGATTTTCCTCCCAAG 59.189 55.000 0.00 0.00 33.30 3.61
252 253 0.497265 GTCGGTACAAATCGCGATCG 59.503 55.000 23.92 19.66 0.00 3.69
278 279 2.559330 GTGGTACCGCCGCAAAAG 59.441 61.111 14.92 0.00 46.73 2.27
287 288 1.444895 GCCGCAAAAGCACCAGATG 60.445 57.895 0.00 0.00 0.00 2.90
411 412 4.700365 CGTCGCGTCCTGCTGACA 62.700 66.667 5.77 0.00 44.71 3.58
1626 2495 2.029290 GGAGGTGAACGCTCTCAAAGTA 60.029 50.000 0.00 0.00 0.00 2.24
1644 2513 1.194772 GTACGCAAGCCTCAACAGAAC 59.805 52.381 0.00 0.00 45.62 3.01
1680 2549 1.620822 GCAAGAAGAAAGGCCCTCAA 58.379 50.000 0.00 0.00 0.00 3.02
2115 3019 9.347240 CATACCTCTTTTGGTTATCATGATTCT 57.653 33.333 14.65 0.00 41.22 2.40
2206 3112 5.007034 TCTTTACTTTGGCGATTGGATGAA 58.993 37.500 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 5.666969 ATCCGAAAAATAATCGAATCGCA 57.333 34.783 0.00 0.00 42.76 5.10
99 100 6.631238 TCAAATCCGAAAAATAATCGAATCGC 59.369 34.615 0.00 0.00 42.76 4.58
100 101 8.713765 ATCAAATCCGAAAAATAATCGAATCG 57.286 30.769 0.00 0.00 42.76 3.34
101 102 9.884465 AGATCAAATCCGAAAAATAATCGAATC 57.116 29.630 0.00 0.00 42.76 2.52
104 105 8.770828 GGTAGATCAAATCCGAAAAATAATCGA 58.229 33.333 0.00 0.00 42.76 3.59
105 106 8.774586 AGGTAGATCAAATCCGAAAAATAATCG 58.225 33.333 0.00 0.00 39.92 3.34
154 155 2.049802 TGTTCGTCCGCTCGGTTC 60.050 61.111 8.28 2.73 36.47 3.62
252 253 0.318784 GGCGGTACCACGATCATCTC 60.319 60.000 13.54 0.00 38.86 2.75
287 288 2.438385 AAAACGACGGCGCATGACAC 62.438 55.000 12.58 0.00 42.48 3.67
957 958 2.124570 ATTACAGCAGGCCAGGCG 60.125 61.111 5.01 7.56 36.08 5.52
958 959 0.817229 GAGATTACAGCAGGCCAGGC 60.817 60.000 5.01 8.72 0.00 4.85
959 960 0.543277 TGAGATTACAGCAGGCCAGG 59.457 55.000 5.01 0.00 0.00 4.45
960 961 2.158856 TCATGAGATTACAGCAGGCCAG 60.159 50.000 5.01 0.00 0.00 4.85
961 962 1.839354 TCATGAGATTACAGCAGGCCA 59.161 47.619 5.01 0.00 0.00 5.36
962 963 2.627515 TCATGAGATTACAGCAGGCC 57.372 50.000 0.00 0.00 0.00 5.19
963 964 5.511234 AAAATCATGAGATTACAGCAGGC 57.489 39.130 0.09 0.00 43.52 4.85
1626 2495 0.463654 TGTTCTGTTGAGGCTTGCGT 60.464 50.000 0.00 0.00 0.00 5.24
1644 2513 4.115199 CCCTTCCGGCCCCTCTTG 62.115 72.222 0.00 0.00 0.00 3.02
2238 3144 6.536582 ACACATCTCAGAACATAACATGCTAC 59.463 38.462 0.00 0.00 0.00 3.58
2519 3425 1.202020 CGGGTACAACAACGCATCATG 60.202 52.381 0.00 0.00 32.86 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.