Multiple sequence alignment - TraesCS5D01G252000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G252000 chr5D 100.000 2750 0 0 1 2750 357884327 357887076 0.000000e+00 5079.0
1 TraesCS5D01G252000 chr5D 95.649 1310 38 8 1 1291 385494730 385493421 0.000000e+00 2085.0
2 TraesCS5D01G252000 chr2D 98.016 2772 33 4 1 2750 536084148 536081377 0.000000e+00 4795.0
3 TraesCS5D01G252000 chr2D 97.476 2773 46 6 1 2750 8945859 8948630 0.000000e+00 4711.0
4 TraesCS5D01G252000 chr2D 97.603 2753 36 14 1 2750 616988169 616990894 0.000000e+00 4691.0
5 TraesCS5D01G252000 chr2D 95.578 1515 26 2 1055 2528 577708574 577707060 0.000000e+00 2388.0
6 TraesCS5D01G252000 chr2D 96.491 228 7 1 2523 2750 577689998 577689772 2.590000e-100 375.0
7 TraesCS5D01G252000 chr2D 97.619 42 1 0 2016 2057 616990118 616990159 3.800000e-09 73.1
8 TraesCS5D01G252000 chr3D 98.928 1586 13 4 1 1582 420457934 420459519 0.000000e+00 2832.0
9 TraesCS5D01G252000 chr3D 94.068 1298 41 7 1473 2750 420459350 420460631 0.000000e+00 1938.0
10 TraesCS5D01G252000 chr7B 95.908 1344 29 8 1 1327 659927220 659925886 0.000000e+00 2154.0
11 TraesCS5D01G252000 chr7B 91.627 1481 88 11 1305 2750 659925849 659924370 0.000000e+00 2015.0
12 TraesCS5D01G252000 chr2B 90.580 1656 106 23 1 1618 679648728 679647085 0.000000e+00 2148.0
13 TraesCS5D01G252000 chr2B 89.083 458 49 1 1405 1861 679647268 679646811 3.970000e-158 568.0
14 TraesCS5D01G252000 chr7A 95.539 1345 39 14 1 1327 483750198 483748857 0.000000e+00 2132.0
15 TraesCS5D01G252000 chr7A 91.139 1501 92 13 1289 2750 483748837 483747339 0.000000e+00 1997.0
16 TraesCS5D01G252000 chr6B 92.342 1358 72 18 3 1332 671654068 671652715 0.000000e+00 1903.0
17 TraesCS5D01G252000 chr6B 91.240 605 42 8 2147 2750 671648789 671648195 0.000000e+00 813.0
18 TraesCS5D01G252000 chr6B 84.299 777 85 17 1356 2113 671649546 671648788 0.000000e+00 725.0
19 TraesCS5D01G252000 chr6B 95.189 291 14 0 2460 2750 638985681 638985971 6.940000e-126 460.0
20 TraesCS5D01G252000 chr7D 89.428 1258 127 6 1 1254 633359768 633358513 0.000000e+00 1581.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G252000 chr5D 357884327 357887076 2749 False 5079.00 5079 100.000000 1 2750 1 chr5D.!!$F1 2749
1 TraesCS5D01G252000 chr5D 385493421 385494730 1309 True 2085.00 2085 95.649000 1 1291 1 chr5D.!!$R1 1290
2 TraesCS5D01G252000 chr2D 536081377 536084148 2771 True 4795.00 4795 98.016000 1 2750 1 chr2D.!!$R1 2749
3 TraesCS5D01G252000 chr2D 8945859 8948630 2771 False 4711.00 4711 97.476000 1 2750 1 chr2D.!!$F1 2749
4 TraesCS5D01G252000 chr2D 577707060 577708574 1514 True 2388.00 2388 95.578000 1055 2528 1 chr2D.!!$R3 1473
5 TraesCS5D01G252000 chr2D 616988169 616990894 2725 False 2382.05 4691 97.611000 1 2750 2 chr2D.!!$F2 2749
6 TraesCS5D01G252000 chr3D 420457934 420460631 2697 False 2385.00 2832 96.498000 1 2750 2 chr3D.!!$F1 2749
7 TraesCS5D01G252000 chr7B 659924370 659927220 2850 True 2084.50 2154 93.767500 1 2750 2 chr7B.!!$R1 2749
8 TraesCS5D01G252000 chr2B 679646811 679648728 1917 True 1358.00 2148 89.831500 1 1861 2 chr2B.!!$R1 1860
9 TraesCS5D01G252000 chr7A 483747339 483750198 2859 True 2064.50 2132 93.339000 1 2750 2 chr7A.!!$R1 2749
10 TraesCS5D01G252000 chr6B 671648195 671654068 5873 True 1147.00 1903 89.293667 3 2750 3 chr6B.!!$R1 2747
11 TraesCS5D01G252000 chr7D 633358513 633359768 1255 True 1581.00 1581 89.428000 1 1254 1 chr7D.!!$R1 1253

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1549 4886 2.988839 GCCACTGCCCCAGGAAGAT 61.989 63.158 0.0 0.0 35.51 2.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2506 5938 2.29507 GGTGGTTGTGGGTATGTTGAAC 59.705 50.0 0.0 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1549 4886 2.988839 GCCACTGCCCCAGGAAGAT 61.989 63.158 0.00 0.00 35.51 2.40
1661 4998 0.175531 GGCCAAACAAGTGCACAACT 59.824 50.000 21.04 0.00 42.60 3.16
1833 5170 2.424956 GCCAGGCATATTAAGGCTATGC 59.575 50.000 6.55 10.78 46.92 3.14
2377 5800 1.661463 TCACCTCCTGCTTCATCCTT 58.339 50.000 0.00 0.00 0.00 3.36
2506 5938 2.121564 GGCAACGGATCATCATGCCG 62.122 60.000 11.34 7.10 46.11 5.69
2583 6015 2.631384 TGAGGGGATGAGGAAGAACAA 58.369 47.619 0.00 0.00 0.00 2.83
2593 6025 6.432472 GGATGAGGAAGAACAAAAGAATGAGT 59.568 38.462 0.00 0.00 0.00 3.41
2723 6155 0.672342 ATAACTTCGCCGGCTCGTAT 59.328 50.000 26.68 11.57 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
777 792 4.374843 TCAAATCCATCTTTGCCATTCG 57.625 40.909 0.00 0.00 36.32 3.34
983 1001 6.814644 CACAGGCATCAAACAATGTTCATAAT 59.185 34.615 0.00 0.00 0.00 1.28
1549 4886 1.002990 CAGTGGCTGGTGCAGATGA 60.003 57.895 0.00 0.00 41.91 2.92
1833 5170 8.213518 TGCAAATAGATTACAAAAGCTAGGAG 57.786 34.615 0.00 0.00 37.04 3.69
1926 5263 3.391965 TGAGCATTTGCAAACAACATCC 58.608 40.909 15.41 1.28 45.16 3.51
2047 5445 4.107622 GGAATGAAATTTGTGATCTGGCG 58.892 43.478 0.00 0.00 36.07 5.69
2506 5938 2.295070 GGTGGTTGTGGGTATGTTGAAC 59.705 50.000 0.00 0.00 0.00 3.18
2583 6015 5.125578 GCCCCGATTTTTCTACTCATTCTTT 59.874 40.000 0.00 0.00 0.00 2.52
2593 6025 3.264964 AGTGGTTAGCCCCGATTTTTCTA 59.735 43.478 0.00 0.00 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.