Multiple sequence alignment - TraesCS5D01G244400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G244400 chr5D 100.000 2692 0 0 439 3130 352831841 352834532 0.000000e+00 4972.0
1 TraesCS5D01G244400 chr5D 96.712 2676 75 9 460 3130 168658281 168655614 0.000000e+00 4442.0
2 TraesCS5D01G244400 chr5D 96.175 2693 92 6 439 3130 265953532 265956214 0.000000e+00 4392.0
3 TraesCS5D01G244400 chr5D 96.033 2697 95 5 439 3130 486198748 486201437 0.000000e+00 4377.0
4 TraesCS5D01G244400 chr5D 100.000 105 0 0 1 105 352831403 352831507 8.860000e-46 195.0
5 TraesCS5D01G244400 chr5D 93.269 104 7 0 1 104 29020428 29020325 1.500000e-33 154.0
6 TraesCS5D01G244400 chr5D 98.039 51 1 0 1 51 15964974 15965024 4.300000e-14 89.8
7 TraesCS5D01G244400 chr6D 97.475 2693 61 2 439 3130 460496051 460498737 0.000000e+00 4590.0
8 TraesCS5D01G244400 chr6D 96.067 2695 90 11 440 3130 429954572 429957254 0.000000e+00 4375.0
9 TraesCS5D01G244400 chr6D 95.556 90 4 0 1 90 460495392 460495481 9.050000e-31 145.0
10 TraesCS5D01G244400 chr2D 96.105 2696 99 4 439 3130 548732437 548735130 0.000000e+00 4392.0
11 TraesCS5D01G244400 chr2D 95.734 2696 100 9 439 3130 375589056 375586372 0.000000e+00 4327.0
12 TraesCS5D01G244400 chr3D 96.144 2697 88 8 439 3130 86230497 86233182 0.000000e+00 4390.0
13 TraesCS5D01G244400 chr7D 96.536 2656 78 9 479 3130 571892573 571889928 0.000000e+00 4383.0
14 TraesCS5D01G244400 chr7D 86.598 97 8 4 1 97 632616531 632616440 5.520000e-18 102.0
15 TraesCS5D01G244400 chr7A 89.157 83 9 0 22 104 82953669 82953751 1.540000e-18 104.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G244400 chr5D 352831403 352834532 3129 False 2583.5 4972 100.0000 1 3130 2 chr5D.!!$F4 3129
1 TraesCS5D01G244400 chr5D 168655614 168658281 2667 True 4442.0 4442 96.7120 460 3130 1 chr5D.!!$R2 2670
2 TraesCS5D01G244400 chr5D 265953532 265956214 2682 False 4392.0 4392 96.1750 439 3130 1 chr5D.!!$F2 2691
3 TraesCS5D01G244400 chr5D 486198748 486201437 2689 False 4377.0 4377 96.0330 439 3130 1 chr5D.!!$F3 2691
4 TraesCS5D01G244400 chr6D 429954572 429957254 2682 False 4375.0 4375 96.0670 440 3130 1 chr6D.!!$F1 2690
5 TraesCS5D01G244400 chr6D 460495392 460498737 3345 False 2367.5 4590 96.5155 1 3130 2 chr6D.!!$F2 3129
6 TraesCS5D01G244400 chr2D 548732437 548735130 2693 False 4392.0 4392 96.1050 439 3130 1 chr2D.!!$F1 2691
7 TraesCS5D01G244400 chr2D 375586372 375589056 2684 True 4327.0 4327 95.7340 439 3130 1 chr2D.!!$R1 2691
8 TraesCS5D01G244400 chr3D 86230497 86233182 2685 False 4390.0 4390 96.1440 439 3130 1 chr3D.!!$F1 2691
9 TraesCS5D01G244400 chr7D 571889928 571892573 2645 True 4383.0 4383 96.5360 479 3130 1 chr7D.!!$R1 2651

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
710 942 1.681076 GCGTAGAACCCCCTGGAAA 59.319 57.895 0.0 0.0 34.81 3.13 F
1677 1914 0.405973 GGAAGGGCAAGAAGAAGGGT 59.594 55.000 0.0 0.0 0.00 4.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1737 1979 0.318441 CAACGGAAGCAGTCCTGAGA 59.682 55.0 0.00 0.0 45.36 3.27 R
2823 3066 1.350310 CCGGGGTGGCCTAACCTATT 61.350 60.0 11.83 0.0 40.35 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
710 942 1.681076 GCGTAGAACCCCCTGGAAA 59.319 57.895 0.00 0.00 34.81 3.13
753 986 4.180817 GCGTATTTGGGCTTTAAAATGCT 58.819 39.130 0.14 0.00 0.00 3.79
968 1202 4.620982 GCTTTGTGCAAAAGATTACCTGT 58.379 39.130 19.18 0.00 42.31 4.00
1028 1262 4.537015 GGAATTGTCAACAAGGAGTTTCG 58.463 43.478 1.69 0.00 38.74 3.46
1175 1409 1.160137 GAAACTGAGAATGCGCAGGT 58.840 50.000 18.32 6.07 44.13 4.00
1210 1444 3.014623 CGTCATCACCTGTCACCTACTA 58.985 50.000 0.00 0.00 0.00 1.82
1409 1643 2.352421 CGACTCTTCGGTTGTGTGGTAT 60.352 50.000 0.00 0.00 41.89 2.73
1445 1679 3.397618 TCCCAGAAGATTGAGAAAACCCA 59.602 43.478 0.00 0.00 0.00 4.51
1655 1892 1.349357 GCCTCAACAGAAGAAGAGGGT 59.651 52.381 9.16 0.00 46.08 4.34
1677 1914 0.405973 GGAAGGGCAAGAAGAAGGGT 59.594 55.000 0.00 0.00 0.00 4.34
1737 1979 2.118294 GCAAGGGAGGGCAAAGGT 59.882 61.111 0.00 0.00 0.00 3.50
2094 2336 3.312828 CTCACTAGTATGGAGATTGCGC 58.687 50.000 0.00 0.00 0.00 6.09
2588 2831 1.154150 GTTGTACCCGGAGTCGACG 60.154 63.158 10.46 0.00 39.00 5.12
2602 2845 1.381429 GTCGACGCGTACTCTTTTGAC 59.619 52.381 13.97 3.16 0.00 3.18
2603 2846 1.265095 TCGACGCGTACTCTTTTGACT 59.735 47.619 13.97 0.00 0.00 3.41
2709 2952 4.657013 TGCAGGTGGTAAACATGTTATCA 58.343 39.130 12.39 7.83 42.63 2.15
2929 3172 2.218759 CGAATCCCGATGATTTCGTGTC 59.781 50.000 2.33 0.00 46.65 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
753 986 2.036604 GCCCAAAAAGTGAATTCCCGAA 59.963 45.455 2.27 0.00 0.00 4.30
1028 1262 1.302832 CCTGTCTGGGCCAACTCAC 60.303 63.158 8.04 2.51 0.00 3.51
1175 1409 2.037121 TGATGACGGAGAAAGTGCAGAA 59.963 45.455 0.00 0.00 0.00 3.02
1210 1444 6.171921 GCTCAGCCATATACTCATCTTTCAT 58.828 40.000 0.00 0.00 0.00 2.57
1315 1549 0.898320 AACCTCAGACGGATCCACTG 59.102 55.000 22.46 22.46 0.00 3.66
1409 1643 3.095912 TCTGGGAGTCGGTAATCTCAA 57.904 47.619 0.00 0.00 32.93 3.02
1445 1679 0.037734 GTCGGGGTGGAAAGTGGATT 59.962 55.000 0.00 0.00 0.00 3.01
1655 1892 0.324943 CTTCTTCTTGCCCTTCCGGA 59.675 55.000 0.00 0.00 0.00 5.14
1737 1979 0.318441 CAACGGAAGCAGTCCTGAGA 59.682 55.000 0.00 0.00 45.36 3.27
1791 2033 1.046472 TCAACGACCTCCTGTGGTGT 61.046 55.000 0.00 0.00 41.00 4.16
2094 2336 1.740025 GAAGAAGCCATTCACTTCCGG 59.260 52.381 0.00 0.00 43.75 5.14
2588 2831 6.420008 TGTCTCTAAAAGTCAAAAGAGTACGC 59.580 38.462 0.00 0.00 37.37 4.42
2602 2845 1.927895 AGCGCGGATGTCTCTAAAAG 58.072 50.000 8.83 0.00 0.00 2.27
2603 2846 3.513680 TTAGCGCGGATGTCTCTAAAA 57.486 42.857 8.83 0.00 0.00 1.52
2709 2952 3.020984 TGTCAAACGAAGGAAGCCTTTT 58.979 40.909 0.00 0.00 44.82 2.27
2823 3066 1.350310 CCGGGGTGGCCTAACCTATT 61.350 60.000 11.83 0.00 40.35 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.