Multiple sequence alignment - TraesCS5D01G239700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G239700 chr5D 100.000 4427 0 0 1 4427 347450740 347446314 0.000000e+00 8176.0
1 TraesCS5D01G239700 chr5D 94.664 581 24 6 1 578 57214442 57213866 0.000000e+00 894.0
2 TraesCS5D01G239700 chr5B 97.001 3668 70 12 790 4427 403702550 403706207 0.000000e+00 6128.0
3 TraesCS5D01G239700 chr5B 84.513 226 22 6 578 791 403702263 403702487 1.250000e-50 211.0
4 TraesCS5D01G239700 chr5B 95.652 46 1 1 576 621 403701951 403701995 6.140000e-09 73.1
5 TraesCS5D01G239700 chr5A 96.803 3566 77 6 887 4427 444527201 444530754 0.000000e+00 5919.0
6 TraesCS5D01G239700 chr5A 91.892 222 10 5 576 791 444526842 444527061 2.000000e-78 303.0
7 TraesCS5D01G239700 chr3A 90.247 851 57 13 2816 3648 431818533 431819375 0.000000e+00 1088.0
8 TraesCS5D01G239700 chr3A 92.373 590 36 9 1 584 647455312 647454726 0.000000e+00 832.0
9 TraesCS5D01G239700 chr3A 93.567 342 13 2 2358 2699 431818071 431818403 6.610000e-138 501.0
10 TraesCS5D01G239700 chr3A 94.798 173 9 0 3643 3815 431819511 431819683 2.030000e-68 270.0
11 TraesCS5D01G239700 chr3A 95.000 100 2 1 629 728 36673641 36673737 2.130000e-33 154.0
12 TraesCS5D01G239700 chr3D 91.969 772 45 7 2816 3577 302934442 302933678 0.000000e+00 1066.0
13 TraesCS5D01G239700 chr3D 91.897 580 39 8 1 576 504980517 504981092 0.000000e+00 804.0
14 TraesCS5D01G239700 chr3D 92.492 333 15 5 2361 2692 302935070 302934747 6.700000e-128 468.0
15 TraesCS5D01G239700 chr3D 91.213 239 15 4 3579 3815 302933510 302933276 1.990000e-83 320.0
16 TraesCS5D01G239700 chr4D 94.502 582 26 6 2 578 499461295 499461875 0.000000e+00 893.0
17 TraesCS5D01G239700 chr7D 93.955 579 32 3 1 576 78863842 78864420 0.000000e+00 872.0
18 TraesCS5D01G239700 chr7D 95.192 104 1 3 632 731 507304306 507304409 1.270000e-35 161.0
19 TraesCS5D01G239700 chr7A 93.115 581 26 7 1 576 733971145 733970574 0.000000e+00 839.0
20 TraesCS5D01G239700 chr6D 92.784 582 31 5 1 578 400769323 400768749 0.000000e+00 832.0
21 TraesCS5D01G239700 chr6D 91.767 583 37 9 4 578 110655590 110656169 0.000000e+00 800.0
22 TraesCS5D01G239700 chr2A 91.552 580 44 4 1 576 104919257 104919835 0.000000e+00 795.0
23 TraesCS5D01G239700 chr1B 97.917 96 1 1 639 733 509565979 509566074 9.850000e-37 165.0
24 TraesCS5D01G239700 chr7B 96.939 98 1 2 633 730 535699011 535699106 3.540000e-36 163.0
25 TraesCS5D01G239700 chr3B 93.519 108 5 2 622 728 44789065 44789171 4.580000e-35 159.0
26 TraesCS5D01G239700 chr3B 95.833 96 2 2 633 728 44812777 44812870 2.130000e-33 154.0
27 TraesCS5D01G239700 chr3B 95.833 96 2 2 633 728 44842242 44842335 2.130000e-33 154.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G239700 chr5D 347446314 347450740 4426 True 8176.000000 8176 100.000000 1 4427 1 chr5D.!!$R2 4426
1 TraesCS5D01G239700 chr5D 57213866 57214442 576 True 894.000000 894 94.664000 1 578 1 chr5D.!!$R1 577
2 TraesCS5D01G239700 chr5B 403701951 403706207 4256 False 2137.366667 6128 92.388667 576 4427 3 chr5B.!!$F1 3851
3 TraesCS5D01G239700 chr5A 444526842 444530754 3912 False 3111.000000 5919 94.347500 576 4427 2 chr5A.!!$F1 3851
4 TraesCS5D01G239700 chr3A 647454726 647455312 586 True 832.000000 832 92.373000 1 584 1 chr3A.!!$R1 583
5 TraesCS5D01G239700 chr3A 431818071 431819683 1612 False 619.666667 1088 92.870667 2358 3815 3 chr3A.!!$F2 1457
6 TraesCS5D01G239700 chr3D 504980517 504981092 575 False 804.000000 804 91.897000 1 576 1 chr3D.!!$F1 575
7 TraesCS5D01G239700 chr3D 302933276 302935070 1794 True 618.000000 1066 91.891333 2361 3815 3 chr3D.!!$R1 1454
8 TraesCS5D01G239700 chr4D 499461295 499461875 580 False 893.000000 893 94.502000 2 578 1 chr4D.!!$F1 576
9 TraesCS5D01G239700 chr7D 78863842 78864420 578 False 872.000000 872 93.955000 1 576 1 chr7D.!!$F1 575
10 TraesCS5D01G239700 chr7A 733970574 733971145 571 True 839.000000 839 93.115000 1 576 1 chr7A.!!$R1 575
11 TraesCS5D01G239700 chr6D 400768749 400769323 574 True 832.000000 832 92.784000 1 578 1 chr6D.!!$R1 577
12 TraesCS5D01G239700 chr6D 110655590 110656169 579 False 800.000000 800 91.767000 4 578 1 chr6D.!!$F1 574
13 TraesCS5D01G239700 chr2A 104919257 104919835 578 False 795.000000 795 91.552000 1 576 1 chr2A.!!$F1 575

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
967 1405 0.467384 CTCACTCCGATTGCATCCCT 59.533 55.000 0.00 0.0 0.00 4.20 F
1776 2223 0.735632 CTGTTCGGCTGCTCAGAGAC 60.736 60.000 0.00 0.0 0.00 3.36 F
2157 2604 1.070758 GTGGACTCAACTGAGCTTGGA 59.929 52.381 6.63 0.0 45.79 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2147 2594 1.002379 AGCTGCCTTCCAAGCTCAG 60.002 57.895 0.0 0.0 31.18 3.35 R
3252 3964 2.604046 ATCGTCCAAGTACAGCATCC 57.396 50.000 0.0 0.0 0.00 3.51 R
4125 5158 1.065418 AGTATGGAGTTCCGCCCAAAG 60.065 52.381 0.0 0.0 39.43 2.77 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
99 100 4.439700 GCGTTGCCAAGATGTAGACTACTA 60.440 45.833 13.67 1.27 0.00 1.82
194 195 1.449423 CATGCCATTCGACGTCCCA 60.449 57.895 10.58 0.00 0.00 4.37
197 198 1.669760 GCCATTCGACGTCCCACAA 60.670 57.895 10.58 0.00 0.00 3.33
453 460 2.309528 TGTTGTTTGTGCGAGAGTCT 57.690 45.000 0.00 0.00 0.00 3.24
542 551 3.476181 CGCGACAAAGTAGTTTTTAGCC 58.524 45.455 0.00 0.00 0.00 3.93
578 587 3.376540 CGGCTGTTAGAGATGCTCTTAC 58.623 50.000 1.88 4.61 41.50 2.34
579 588 3.181486 CGGCTGTTAGAGATGCTCTTACA 60.181 47.826 13.54 13.54 44.33 2.41
581 590 5.363939 GGCTGTTAGAGATGCTCTTACAAT 58.636 41.667 14.67 0.00 45.28 2.71
740 1081 4.139859 CATCTTGACTTGATGGCTCTCT 57.860 45.455 0.00 0.00 38.04 3.10
765 1106 6.514947 TCTGCAATCAAGCTAAACATTTTGT 58.485 32.000 0.00 0.00 34.99 2.83
768 1109 6.867816 TGCAATCAAGCTAAACATTTTGTAGG 59.132 34.615 0.00 0.00 34.99 3.18
769 1110 7.090173 GCAATCAAGCTAAACATTTTGTAGGA 58.910 34.615 0.00 0.00 0.00 2.94
791 1132 3.048600 AGCAATGAGGGCTACCATTCTA 58.951 45.455 0.00 0.00 40.47 2.10
793 1134 3.817647 GCAATGAGGGCTACCATTCTAAG 59.182 47.826 0.00 0.00 40.13 2.18
842 1251 3.744426 GCTACGAGTACAAACCACAATGT 59.256 43.478 0.00 0.00 0.00 2.71
843 1252 4.212636 GCTACGAGTACAAACCACAATGTT 59.787 41.667 0.00 0.00 0.00 2.71
844 1253 5.277634 GCTACGAGTACAAACCACAATGTTT 60.278 40.000 0.00 0.00 38.95 2.83
967 1405 0.467384 CTCACTCCGATTGCATCCCT 59.533 55.000 0.00 0.00 0.00 4.20
970 1408 1.414181 CACTCCGATTGCATCCCTACT 59.586 52.381 0.00 0.00 0.00 2.57
1053 1491 1.878522 CCACATACGCACGCTCTCC 60.879 63.158 0.00 0.00 0.00 3.71
1335 1782 2.045926 GGCATGGTCGACCTGCTT 60.046 61.111 36.01 20.26 38.95 3.91
1689 2136 1.529309 GGAGTTCTGGAGGATGCCC 59.471 63.158 0.00 0.00 0.00 5.36
1776 2223 0.735632 CTGTTCGGCTGCTCAGAGAC 60.736 60.000 0.00 0.00 0.00 3.36
1812 2259 4.390603 GGCGTGTCTATCAACAAATACACA 59.609 41.667 0.00 0.00 37.63 3.72
1962 2409 5.179452 ACGCTAATATTGGGGCTATTGAT 57.821 39.130 14.62 0.00 0.00 2.57
2019 2466 6.296026 AGTAAGCAACAAAAGTATCTGGTCA 58.704 36.000 0.00 0.00 0.00 4.02
2070 2517 4.215908 ACCTACCGAGATCAATTCAGCTA 58.784 43.478 0.00 0.00 0.00 3.32
2147 2594 5.757850 ATTTTCAGTTCTGTGGACTCAAC 57.242 39.130 0.00 0.00 0.00 3.18
2157 2604 1.070758 GTGGACTCAACTGAGCTTGGA 59.929 52.381 6.63 0.00 45.79 3.53
2574 3021 9.600646 GAAGTACAAACAGCTAGAAGAATTTTC 57.399 33.333 0.00 0.00 0.00 2.29
3252 3964 1.130749 GCTGCTTGCAGAGTTCATGAG 59.869 52.381 24.67 0.00 42.31 2.90
3609 4497 5.163663 TGTTGAGCCTTTTTACACTGTTCAG 60.164 40.000 0.00 0.00 0.00 3.02
3612 4500 3.066760 AGCCTTTTTACACTGTTCAGCAC 59.933 43.478 0.00 0.00 0.00 4.40
3751 4782 5.182760 CAGGCTCTTTGCTGAACTTAATTCT 59.817 40.000 0.00 0.00 42.39 2.40
4132 5165 4.041075 TCAAAGGGGAATTTTACTTTGGGC 59.959 41.667 20.10 0.00 45.90 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 5.295431 TGTACCAAAGCATTTTCTGATCG 57.705 39.130 0.00 0.00 35.03 3.69
80 81 6.129874 ACTGATAGTAGTCTACATCTTGGCA 58.870 40.000 12.54 0.00 0.00 4.92
99 100 3.378512 TGTCCCAAGAGCTCATACTGAT 58.621 45.455 17.77 0.00 0.00 2.90
194 195 3.845178 TCTGAAGATCGTTATGCGTTGT 58.155 40.909 0.00 0.00 42.13 3.32
197 198 3.130516 TCCTTCTGAAGATCGTTATGCGT 59.869 43.478 18.68 0.00 42.13 5.24
398 404 8.392612 CAAAACAGAAGCAAAAAGATCAAACAT 58.607 29.630 0.00 0.00 0.00 2.71
453 460 2.800331 CAAAAATGCAGCGCGCGA 60.800 55.556 37.18 13.84 46.97 5.87
525 534 2.224784 CGCGGGCTAAAAACTACTTTGT 59.775 45.455 0.00 0.00 0.00 2.83
578 587 6.429385 GCCCTCATCCTAGTTTCATCTTATTG 59.571 42.308 0.00 0.00 0.00 1.90
579 588 6.101734 TGCCCTCATCCTAGTTTCATCTTATT 59.898 38.462 0.00 0.00 0.00 1.40
581 590 4.968719 TGCCCTCATCCTAGTTTCATCTTA 59.031 41.667 0.00 0.00 0.00 2.10
640 981 6.947733 TCAAATCCCACTCTTGACATACAATT 59.052 34.615 0.00 0.00 37.88 2.32
641 982 6.484288 TCAAATCCCACTCTTGACATACAAT 58.516 36.000 0.00 0.00 37.88 2.71
642 983 5.875224 TCAAATCCCACTCTTGACATACAA 58.125 37.500 0.00 0.00 36.97 2.41
734 1075 2.358015 AGCTTGATTGCAGAAGAGAGC 58.642 47.619 6.43 4.18 34.99 4.09
739 1080 7.170320 ACAAAATGTTTAGCTTGATTGCAGAAG 59.830 33.333 0.00 0.00 34.99 2.85
740 1081 6.985645 ACAAAATGTTTAGCTTGATTGCAGAA 59.014 30.769 0.00 0.00 34.99 3.02
765 1106 1.768870 GGTAGCCCTCATTGCTTCCTA 59.231 52.381 0.00 0.00 41.53 2.94
768 1109 2.355010 ATGGTAGCCCTCATTGCTTC 57.645 50.000 0.00 0.00 40.23 3.86
769 1110 2.243221 AGAATGGTAGCCCTCATTGCTT 59.757 45.455 0.00 0.00 40.23 3.91
791 1132 2.171448 CCATGCAAGTCTAGCCTACCTT 59.829 50.000 0.00 0.00 0.00 3.50
793 1134 1.202698 CCCATGCAAGTCTAGCCTACC 60.203 57.143 0.00 0.00 0.00 3.18
842 1251 3.650070 TGTTGCACACAAAGTCACAAA 57.350 38.095 0.00 0.00 37.58 2.83
843 1252 3.192212 TGATGTTGCACACAAAGTCACAA 59.808 39.130 5.94 0.00 39.50 3.33
844 1253 2.751806 TGATGTTGCACACAAAGTCACA 59.248 40.909 5.94 0.00 39.50 3.58
845 1254 3.108144 GTGATGTTGCACACAAAGTCAC 58.892 45.455 13.44 13.44 41.33 3.67
846 1255 2.751806 TGTGATGTTGCACACAAAGTCA 59.248 40.909 5.47 3.42 43.35 3.41
847 1256 3.419264 TGTGATGTTGCACACAAAGTC 57.581 42.857 5.47 1.19 43.35 3.01
872 1281 1.592223 GGAGTCGGCTTGCTAGTGT 59.408 57.895 0.00 0.00 0.00 3.55
945 1369 0.528466 GATGCAATCGGAGTGAGCGA 60.528 55.000 9.97 0.00 31.13 4.93
967 1405 2.697761 GCAGAGACGGCGTGGAGTA 61.698 63.158 21.19 0.00 0.00 2.59
1689 2136 2.168054 GGAAACCACATTCCGGACG 58.832 57.895 1.83 0.00 39.54 4.79
1797 2244 7.552459 TGCTAGTAGCTGTGTATTTGTTGATA 58.448 34.615 22.34 0.00 42.97 2.15
1962 2409 1.409790 TCGAACACCTTCTCGGACAAA 59.590 47.619 0.00 0.00 35.76 2.83
2019 2466 7.072454 TGGCTACTAATCCCAGATATGAAAGTT 59.928 37.037 0.00 0.00 0.00 2.66
2147 2594 1.002379 AGCTGCCTTCCAAGCTCAG 60.002 57.895 0.00 0.00 31.18 3.35
2157 2604 2.360852 AGCGAATGCAGCTGCCTT 60.361 55.556 34.64 30.44 44.22 4.35
3252 3964 2.604046 ATCGTCCAAGTACAGCATCC 57.396 50.000 0.00 0.00 0.00 3.51
3612 4500 8.487176 GTTTAGAACAACTACCAATGCAAAATG 58.513 33.333 0.00 0.00 0.00 2.32
4001 5032 4.096984 CCAATAGCTGCTCGAAGGAAAAAT 59.903 41.667 4.91 0.00 0.00 1.82
4125 5158 1.065418 AGTATGGAGTTCCGCCCAAAG 60.065 52.381 0.00 0.00 39.43 2.77
4132 5165 2.158900 AGGCAATGAGTATGGAGTTCCG 60.159 50.000 0.00 0.00 39.43 4.30
4335 5368 0.835276 CCAGAGGTCATCAGATGCCA 59.165 55.000 19.91 0.00 0.00 4.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.