Multiple sequence alignment - TraesCS5D01G236800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G236800 chr5D 100.000 2386 0 0 1 2386 345437275 345439660 0.000000e+00 4407
1 TraesCS5D01G236800 chr5D 95.494 1509 56 7 882 2386 345424254 345425754 0.000000e+00 2399
2 TraesCS5D01G236800 chr5D 95.677 694 27 3 367 1060 345358123 345358813 0.000000e+00 1112
3 TraesCS5D01G236800 chr5D 94.490 363 19 1 14 375 345356997 345357359 2.070000e-155 558
4 TraesCS5D01G236800 chr5D 90.909 330 29 1 164 493 296662659 296662331 2.180000e-120 442
5 TraesCS5D01G236800 chr5A 93.319 2260 129 13 103 2349 445768698 445766448 0.000000e+00 3317
6 TraesCS5D01G236800 chr5A 92.612 2247 151 10 102 2344 446040113 446037878 0.000000e+00 3216
7 TraesCS5D01G236800 chr5A 92.167 2247 155 13 102 2344 446025067 446022838 0.000000e+00 3155
8 TraesCS5D01G236800 chr5A 92.126 2248 138 14 102 2344 445810545 445812758 0.000000e+00 3134
9 TraesCS5D01G236800 chr5A 92.821 2145 114 9 254 2386 445672802 445670686 0.000000e+00 3072
10 TraesCS5D01G236800 chr5A 92.325 1329 87 9 1020 2344 446022161 446020844 0.000000e+00 1875
11 TraesCS5D01G236800 chr2D 91.372 1159 81 10 498 1652 61271944 61273087 0.000000e+00 1568
12 TraesCS5D01G236800 chr2D 87.712 765 62 20 1646 2386 61268731 61269487 0.000000e+00 863
13 TraesCS5D01G236800 chr2A 90.423 1159 93 11 498 1652 61773155 61774299 0.000000e+00 1509
14 TraesCS5D01G236800 chr5B 89.816 815 68 8 1576 2386 406400219 406399416 0.000000e+00 1031
15 TraesCS5D01G236800 chr5B 90.053 754 65 6 17 769 406406854 406406110 0.000000e+00 968
16 TraesCS5D01G236800 chr2B 83.333 468 78 0 25 492 33853196 33852729 1.310000e-117 433
17 TraesCS5D01G236800 chr2B 83.369 469 76 2 25 492 33857976 33857509 1.310000e-117 433


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G236800 chr5D 345437275 345439660 2385 False 4407.0 4407 100.0000 1 2386 1 chr5D.!!$F2 2385
1 TraesCS5D01G236800 chr5D 345424254 345425754 1500 False 2399.0 2399 95.4940 882 2386 1 chr5D.!!$F1 1504
2 TraesCS5D01G236800 chr5D 345356997 345358813 1816 False 835.0 1112 95.0835 14 1060 2 chr5D.!!$F3 1046
3 TraesCS5D01G236800 chr5A 445766448 445768698 2250 True 3317.0 3317 93.3190 103 2349 1 chr5A.!!$R2 2246
4 TraesCS5D01G236800 chr5A 446037878 446040113 2235 True 3216.0 3216 92.6120 102 2344 1 chr5A.!!$R3 2242
5 TraesCS5D01G236800 chr5A 445810545 445812758 2213 False 3134.0 3134 92.1260 102 2344 1 chr5A.!!$F1 2242
6 TraesCS5D01G236800 chr5A 445670686 445672802 2116 True 3072.0 3072 92.8210 254 2386 1 chr5A.!!$R1 2132
7 TraesCS5D01G236800 chr5A 446020844 446025067 4223 True 2515.0 3155 92.2460 102 2344 2 chr5A.!!$R4 2242
8 TraesCS5D01G236800 chr2D 61268731 61273087 4356 False 1215.5 1568 89.5420 498 2386 2 chr2D.!!$F1 1888
9 TraesCS5D01G236800 chr2A 61773155 61774299 1144 False 1509.0 1509 90.4230 498 1652 1 chr2A.!!$F1 1154
10 TraesCS5D01G236800 chr5B 406399416 406400219 803 True 1031.0 1031 89.8160 1576 2386 1 chr5B.!!$R1 810
11 TraesCS5D01G236800 chr5B 406406110 406406854 744 True 968.0 968 90.0530 17 769 1 chr5B.!!$R2 752

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
50 51 0.683973 AGCTGACTTCACACCCTCAG 59.316 55.000 0.0 0.0 34.43 3.35 F
453 1228 1.940613 GGATGCGGTTGTATCACCTTC 59.059 52.381 0.0 0.0 38.80 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1169 3930 1.191489 TGGCAGGATCCACACGAGAA 61.191 55.000 15.82 0.0 0.0 2.87 R
2161 4936 1.202359 ACCCGACATTTGCAACAACAC 60.202 47.619 0.00 0.0 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 2.186826 GGTGACCGTTGTTGCAGCT 61.187 57.895 1.17 0.00 0.00 4.24
50 51 0.683973 AGCTGACTTCACACCCTCAG 59.316 55.000 0.00 0.00 34.43 3.35
172 173 5.941948 ACCTTGACTTCAAAGGTTATTCG 57.058 39.130 1.99 0.00 35.40 3.34
241 243 4.626172 GGAGGACAGAGACATTTTTACGAC 59.374 45.833 0.00 0.00 0.00 4.34
362 365 6.500684 TTGGTTTATTTTTGCTGCAAAACA 57.499 29.167 33.11 24.54 42.02 2.83
453 1228 1.940613 GGATGCGGTTGTATCACCTTC 59.059 52.381 0.00 0.00 38.80 3.46
540 3257 4.799564 TGAATTATTCCTTTGGTGCCAC 57.200 40.909 2.22 0.00 0.00 5.01
970 3722 2.356135 GAAGAACCGCCAAGCTTGATA 58.644 47.619 28.05 0.00 0.00 2.15
1126 3887 6.996509 AGTTCAAACTACCGGTTAACTGATA 58.003 36.000 15.04 1.69 36.16 2.15
1169 3930 1.069765 CTCAGTGTGTCAGGCGGTT 59.930 57.895 0.00 0.00 0.00 4.44
1188 3949 1.191489 TTCTCGTGTGGATCCTGCCA 61.191 55.000 14.23 4.25 35.02 4.92
1438 4199 1.674359 TGTGATGTTGTTTGGCTCGT 58.326 45.000 0.00 0.00 0.00 4.18
1712 4478 2.278245 ACCATGAGAGGTGGAATTCCA 58.722 47.619 23.63 23.63 45.30 3.53
1722 4493 1.076705 GGAATTCCAGACAGGGGGC 60.077 63.158 20.04 0.00 38.24 5.80
1809 4580 4.394729 TCACCAACCAAAGATAACCTCAC 58.605 43.478 0.00 0.00 0.00 3.51
1951 4725 4.494484 AGTTGTTGTTGTTTGCTCCTTTC 58.506 39.130 0.00 0.00 0.00 2.62
1975 4749 3.427638 CGAGGATGTGTACATGTCGTTCT 60.428 47.826 0.00 0.00 36.57 3.01
2052 4826 9.581099 TTTTCTAAAAACAAGATGTTGGAGTTC 57.419 29.630 7.59 0.00 40.14 3.01
2161 4936 6.648879 TCCTAAATGTCTTTTTGACTTGGG 57.351 37.500 0.00 0.00 45.54 4.12
2189 4966 2.502130 TGCAAATGTCGGGTGTCCTATA 59.498 45.455 0.00 0.00 0.00 1.31
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 1.367471 CGCTGAGGGTGTGAAGTCA 59.633 57.895 0.00 0.00 0.00 3.41
420 1195 1.656818 CGCATCCAAAGAATGCCCGT 61.657 55.000 2.76 0.00 38.01 5.28
540 3257 6.370442 CGTCTTGGTAGGATCTCTACTCTATG 59.630 46.154 16.24 9.01 45.78 2.23
970 3722 0.458543 CACTGCTGTTACGGCGATCT 60.459 55.000 16.62 0.00 38.82 2.75
1126 3887 5.673568 GCATCGTGTATGTAAACAAGCACAT 60.674 40.000 15.65 0.00 37.93 3.21
1169 3930 1.191489 TGGCAGGATCCACACGAGAA 61.191 55.000 15.82 0.00 0.00 2.87
1188 3949 3.637273 GTTCACCGCCACCCCTCT 61.637 66.667 0.00 0.00 0.00 3.69
1438 4199 6.603940 ATGGGCAGCAAGTTTTATTTCTTA 57.396 33.333 0.00 0.00 0.00 2.10
1712 4478 3.966543 CCGTTTGGCCCCCTGTCT 61.967 66.667 0.00 0.00 0.00 3.41
1809 4580 2.009774 GTCATGTCCGTCCTTGATTGG 58.990 52.381 0.00 0.00 0.00 3.16
1951 4725 2.185262 CGACATGTACACATCCTCGTG 58.815 52.381 0.00 0.00 42.81 4.35
1975 4749 4.155099 TCTTGAAACGTTGCTTCAACAAGA 59.845 37.500 8.00 13.27 43.70 3.02
2052 4826 4.418013 TCAGCACGTGACAATAATTTGG 57.582 40.909 22.23 0.00 37.15 3.28
2161 4936 1.202359 ACCCGACATTTGCAACAACAC 60.202 47.619 0.00 0.00 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.