Multiple sequence alignment - TraesCS5D01G221300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G221300 chr5D 100.000 2453 0 0 1 2453 329161456 329163908 0.000000e+00 4530
1 TraesCS5D01G221300 chr5D 97.686 1772 36 5 683 2452 6201320 6199552 0.000000e+00 3040
2 TraesCS5D01G221300 chr5D 98.298 1645 26 2 810 2453 560872556 560874199 0.000000e+00 2881
3 TraesCS5D01G221300 chr5D 97.947 682 11 3 1 680 503298413 503297733 0.000000e+00 1179
4 TraesCS5D01G221300 chr5D 97.797 681 13 2 1 680 6170403 6171082 0.000000e+00 1173
5 TraesCS5D01G221300 chr5D 97.651 681 13 3 1 680 6269470 6270148 0.000000e+00 1166
6 TraesCS5D01G221300 chr1D 97.744 1773 37 3 683 2453 254497958 254499729 0.000000e+00 3049
7 TraesCS5D01G221300 chr1D 92.568 1776 90 24 683 2453 244484088 244482350 0.000000e+00 2510
8 TraesCS5D01G221300 chr1D 97.797 681 11 4 1 680 254441546 254440869 0.000000e+00 1171
9 TraesCS5D01G221300 chr1D 97.504 681 14 3 1 680 298346230 298346908 0.000000e+00 1160
10 TraesCS5D01G221300 chr1A 96.558 1772 53 6 683 2453 168450604 168448840 0.000000e+00 2928
11 TraesCS5D01G221300 chr4D 96.388 1772 60 4 683 2453 19916456 19918224 0.000000e+00 2915
12 TraesCS5D01G221300 chr7A 94.416 1773 93 6 683 2453 352194063 352192295 0.000000e+00 2721
13 TraesCS5D01G221300 chr7A 95.717 467 14 4 1865 2330 58647293 58647754 0.000000e+00 747
14 TraesCS5D01G221300 chr6B 96.708 1519 46 4 683 2199 22425905 22427421 0.000000e+00 2525
15 TraesCS5D01G221300 chr3D 97.931 1160 24 0 683 1842 21904588 21905747 0.000000e+00 2010
16 TraesCS5D01G221300 chr3D 97.797 681 11 4 1 680 323521556 323520879 0.000000e+00 1171
17 TraesCS5D01G221300 chr2D 98.091 681 11 2 1 680 638430937 638430258 0.000000e+00 1184
18 TraesCS5D01G221300 chr4B 96.356 686 17 3 1 680 308673258 308673941 0.000000e+00 1122
19 TraesCS5D01G221300 chr4A 96.340 683 20 4 1 680 309483517 309484197 0.000000e+00 1118
20 TraesCS5D01G221300 chr3B 96.244 213 7 1 2239 2451 524777564 524777353 5.020000e-92 348
21 TraesCS5D01G221300 chr2B 91.667 204 11 4 2239 2437 799021656 799021454 6.680000e-71 278
22 TraesCS5D01G221300 chr7D 99.265 136 1 0 2318 2453 231553189 231553324 1.880000e-61 246


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G221300 chr5D 329161456 329163908 2452 False 4530 4530 100.000 1 2453 1 chr5D.!!$F3 2452
1 TraesCS5D01G221300 chr5D 6199552 6201320 1768 True 3040 3040 97.686 683 2452 1 chr5D.!!$R1 1769
2 TraesCS5D01G221300 chr5D 560872556 560874199 1643 False 2881 2881 98.298 810 2453 1 chr5D.!!$F4 1643
3 TraesCS5D01G221300 chr5D 503297733 503298413 680 True 1179 1179 97.947 1 680 1 chr5D.!!$R2 679
4 TraesCS5D01G221300 chr5D 6170403 6171082 679 False 1173 1173 97.797 1 680 1 chr5D.!!$F1 679
5 TraesCS5D01G221300 chr5D 6269470 6270148 678 False 1166 1166 97.651 1 680 1 chr5D.!!$F2 679
6 TraesCS5D01G221300 chr1D 254497958 254499729 1771 False 3049 3049 97.744 683 2453 1 chr1D.!!$F1 1770
7 TraesCS5D01G221300 chr1D 244482350 244484088 1738 True 2510 2510 92.568 683 2453 1 chr1D.!!$R1 1770
8 TraesCS5D01G221300 chr1D 254440869 254441546 677 True 1171 1171 97.797 1 680 1 chr1D.!!$R2 679
9 TraesCS5D01G221300 chr1D 298346230 298346908 678 False 1160 1160 97.504 1 680 1 chr1D.!!$F2 679
10 TraesCS5D01G221300 chr1A 168448840 168450604 1764 True 2928 2928 96.558 683 2453 1 chr1A.!!$R1 1770
11 TraesCS5D01G221300 chr4D 19916456 19918224 1768 False 2915 2915 96.388 683 2453 1 chr4D.!!$F1 1770
12 TraesCS5D01G221300 chr7A 352192295 352194063 1768 True 2721 2721 94.416 683 2453 1 chr7A.!!$R1 1770
13 TraesCS5D01G221300 chr6B 22425905 22427421 1516 False 2525 2525 96.708 683 2199 1 chr6B.!!$F1 1516
14 TraesCS5D01G221300 chr3D 21904588 21905747 1159 False 2010 2010 97.931 683 1842 1 chr3D.!!$F1 1159
15 TraesCS5D01G221300 chr3D 323520879 323521556 677 True 1171 1171 97.797 1 680 1 chr3D.!!$R1 679
16 TraesCS5D01G221300 chr2D 638430258 638430937 679 True 1184 1184 98.091 1 680 1 chr2D.!!$R1 679
17 TraesCS5D01G221300 chr4B 308673258 308673941 683 False 1122 1122 96.356 1 680 1 chr4B.!!$F1 679
18 TraesCS5D01G221300 chr4A 309483517 309484197 680 False 1118 1118 96.340 1 680 1 chr4A.!!$F1 679

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
680 691 2.225467 GGTAGGGCTTGCATTCTGATC 58.775 52.381 0.0 0.0 0.0 2.92 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2199 2215 4.322101 CGTCCAGTAAAACGGAAGAATG 57.678 45.455 0.0 0.0 33.13 2.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
199 200 3.698040 CCTTCCATGGATTCTTTGGTCAG 59.302 47.826 17.06 5.50 0.00 3.51
403 412 5.048713 CCACACTTTAAGATTCCAACCAGAC 60.049 44.000 0.00 0.00 0.00 3.51
547 557 7.451877 AGAAGTAGGAACTAGAATGAACAGTGA 59.548 37.037 0.00 0.00 44.14 3.41
548 558 7.726033 AGTAGGAACTAGAATGAACAGTGAT 57.274 36.000 0.00 0.00 44.14 3.06
680 691 2.225467 GGTAGGGCTTGCATTCTGATC 58.775 52.381 0.00 0.00 0.00 2.92
681 692 2.421952 GGTAGGGCTTGCATTCTGATCA 60.422 50.000 0.00 0.00 0.00 2.92
811 822 8.514330 AGTTATCAATGGTTTAGCCGAAAATA 57.486 30.769 0.00 0.00 41.21 1.40
1274 1287 1.973812 GCAGCAGTCCAAGGGGTTC 60.974 63.158 0.00 0.00 34.93 3.62
1285 1298 3.117963 TCCAAGGGGTTCGTTCACTTTTA 60.118 43.478 0.00 0.00 34.93 1.52
1306 1319 2.821969 AGTCATGCTACCTTTGCTTTGG 59.178 45.455 0.00 0.00 0.00 3.28
1636 1649 8.995027 AATCTATGGAAGCATTGGTTTATACA 57.005 30.769 2.14 1.43 0.00 2.29
1645 1658 9.435688 GAAGCATTGGTTTATACATTCCTTTTT 57.564 29.630 2.14 0.00 0.00 1.94
1667 1680 9.685828 TTTTTGTTTCGACTTTAGGGATAATTG 57.314 29.630 0.00 0.00 0.00 2.32
1903 1917 2.280628 GGAGATGGCGACTAAAGTTGG 58.719 52.381 0.00 0.00 0.00 3.77
2109 2125 6.796785 AACCCTTGAATTCAGAATAATGGG 57.203 37.500 19.22 19.22 37.08 4.00
2340 2357 1.389609 ATGGTAGTTCGACCGCGGAT 61.390 55.000 35.90 16.95 42.99 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
227 231 7.465353 TTGCATCCACTTAATTTCAATCAGA 57.535 32.000 0.00 0.00 0.00 3.27
680 691 3.470709 CCATACCACATAGTTCCAGCTG 58.529 50.000 6.78 6.78 0.00 4.24
681 692 2.439507 CCCATACCACATAGTTCCAGCT 59.560 50.000 0.00 0.00 0.00 4.24
791 802 8.514330 ACTAATATTTTCGGCTAAACCATTGA 57.486 30.769 0.00 0.00 39.03 2.57
811 822 9.959721 TTTAGACCAAGCTTCTGATAAACTAAT 57.040 29.630 0.00 0.00 0.00 1.73
889 900 1.143684 GCCTGCTCTGAATAATCCCCA 59.856 52.381 0.00 0.00 0.00 4.96
1255 1268 2.697147 GAACCCCTTGGACTGCTGCA 62.697 60.000 0.88 0.88 34.81 4.41
1274 1287 4.929808 AGGTAGCATGACTAAAAGTGAACG 59.070 41.667 0.00 0.00 30.90 3.95
1285 1298 2.821969 CCAAAGCAAAGGTAGCATGACT 59.178 45.455 0.00 0.00 0.00 3.41
1306 1319 4.976116 CCAAATGTGTCCGAAAAAGAAGAC 59.024 41.667 0.00 0.00 0.00 3.01
1416 1429 2.418746 CCTTGTAGTTGGATCTCCCACG 60.419 54.545 0.00 0.00 46.62 4.94
1636 1649 6.548251 TCCCTAAAGTCGAAACAAAAAGGAAT 59.452 34.615 0.00 0.00 0.00 3.01
1645 1658 7.989416 AACAATTATCCCTAAAGTCGAAACA 57.011 32.000 0.00 0.00 0.00 2.83
1667 1680 4.421948 TCTCGGAAGAAGATAGCGAAAAC 58.578 43.478 0.00 0.00 41.32 2.43
2199 2215 4.322101 CGTCCAGTAAAACGGAAGAATG 57.678 45.455 0.00 0.00 33.13 2.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.