Multiple sequence alignment - TraesCS5D01G221200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G221200 chr5D 100.000 2224 0 0 1 2224 329151190 329153413 0 4108
1 TraesCS5D01G221200 chr5D 97.888 2225 43 4 1 2224 503304531 503302310 0 3845
2 TraesCS5D01G221200 chr5D 97.663 2225 48 4 1 2224 6164253 6166474 0 3818
3 TraesCS5D01G221200 chr5D 98.391 1989 31 1 237 2224 6263515 6265503 0 3494
4 TraesCS5D01G221200 chr5D 97.944 924 19 0 1 924 6262244 6263167 0 1602
5 TraesCS5D01G221200 chr3B 98.382 2225 35 1 1 2224 101907484 101909708 0 3908
6 TraesCS5D01G221200 chr1D 97.933 2225 41 4 1 2224 254447698 254445478 0 3849
7 TraesCS5D01G221200 chr1D 97.303 2225 59 1 1 2224 51859372 51861596 0 3775
8 TraesCS5D01G221200 chr4D 96.586 2197 70 3 29 2224 19881121 19878929 0 3637
9 TraesCS5D01G221200 chr4D 96.093 819 30 2 568 1386 206989030 206989846 0 1334
10 TraesCS5D01G221200 chr4A 96.750 1631 51 2 3 1632 309477661 309479290 0 2717
11 TraesCS5D01G221200 chr1B 94.323 1145 62 3 984 2128 427649981 427648840 0 1751
12 TraesCS5D01G221200 chrUn 98.469 849 13 0 1376 2224 439346593 439345745 0 1496


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G221200 chr5D 329151190 329153413 2223 False 4108 4108 100.0000 1 2224 1 chr5D.!!$F2 2223
1 TraesCS5D01G221200 chr5D 503302310 503304531 2221 True 3845 3845 97.8880 1 2224 1 chr5D.!!$R1 2223
2 TraesCS5D01G221200 chr5D 6164253 6166474 2221 False 3818 3818 97.6630 1 2224 1 chr5D.!!$F1 2223
3 TraesCS5D01G221200 chr5D 6262244 6265503 3259 False 2548 3494 98.1675 1 2224 2 chr5D.!!$F3 2223
4 TraesCS5D01G221200 chr3B 101907484 101909708 2224 False 3908 3908 98.3820 1 2224 1 chr3B.!!$F1 2223
5 TraesCS5D01G221200 chr1D 254445478 254447698 2220 True 3849 3849 97.9330 1 2224 1 chr1D.!!$R1 2223
6 TraesCS5D01G221200 chr1D 51859372 51861596 2224 False 3775 3775 97.3030 1 2224 1 chr1D.!!$F1 2223
7 TraesCS5D01G221200 chr4D 19878929 19881121 2192 True 3637 3637 96.5860 29 2224 1 chr4D.!!$R1 2195
8 TraesCS5D01G221200 chr4D 206989030 206989846 816 False 1334 1334 96.0930 568 1386 1 chr4D.!!$F1 818
9 TraesCS5D01G221200 chr4A 309477661 309479290 1629 False 2717 2717 96.7500 3 1632 1 chr4A.!!$F1 1629
10 TraesCS5D01G221200 chr1B 427648840 427649981 1141 True 1751 1751 94.3230 984 2128 1 chr1B.!!$R1 1144
11 TraesCS5D01G221200 chrUn 439345745 439346593 848 True 1496 1496 98.4690 1376 2224 1 chrUn.!!$R1 848

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
285 286 0.179215 CGCTCGAGAATTGCCACAAC 60.179 55.0 18.75 0.0 0.0 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2060 3097 1.270358 GCAGTTCCACTTTCTCGGTCT 60.27 52.381 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 3.270877 GGCCTAGCAAAAGAGAAATCGA 58.729 45.455 0.00 0.00 0.00 3.59
138 139 5.857517 GCGATATAACTAGGAAGACCTTTCG 59.142 44.000 0.00 0.00 45.36 3.46
222 223 4.469945 TCCGAGAATCCACAAATTCTACCT 59.530 41.667 0.00 0.00 44.16 3.08
239 240 2.209273 ACCTCGCATTTTTGGCAAAAC 58.791 42.857 24.04 12.50 34.63 2.43
285 286 0.179215 CGCTCGAGAATTGCCACAAC 60.179 55.000 18.75 0.00 0.00 3.32
328 1364 4.229876 GGTCCAAAGATTCTTTCGCAAAG 58.770 43.478 8.71 0.00 39.88 2.77
623 1659 1.736126 TCGTAGTTCTCGAACGAGCAT 59.264 47.619 17.71 9.33 45.50 3.79
862 1898 2.022918 AGTGAGTAGGGCCCAGTAGAAT 60.023 50.000 27.56 2.98 0.00 2.40
956 1992 1.128188 AAGGGGTCGCCTGTTCTTCT 61.128 55.000 9.61 0.00 0.00 2.85
1311 2348 2.621055 TCCCCAACTTTGATTTCACGTG 59.379 45.455 9.94 9.94 0.00 4.49
1357 2394 2.125633 GTCGAGCGGGTCCCTTTC 60.126 66.667 6.29 2.38 0.00 2.62
1374 2411 3.546815 CCTTTCGATCCATTTCACATCGC 60.547 47.826 0.00 0.00 39.42 4.58
1539 2576 9.245962 CTACTAAAATATCACCAGTTTCTACCG 57.754 37.037 0.00 0.00 0.00 4.02
1658 2695 4.338964 TGGCTTGTCGTATCCGTCTAAATA 59.661 41.667 0.00 0.00 35.01 1.40
1670 2707 7.772332 ATCCGTCTAAATATCATATTTCCGC 57.228 36.000 5.88 0.00 0.00 5.54
1992 3029 0.179145 GATCTTTCCCTCGCGTTCGA 60.179 55.000 5.77 0.00 43.28 3.71
2020 3057 3.709587 TGGAAACCCTCGAATCTAGAGT 58.290 45.455 0.00 0.00 34.08 3.24
2060 3097 4.262121 CCAGTTCCAACAATGCATTTCTCA 60.262 41.667 9.83 0.00 0.00 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 2.091444 AGTTGGAGGGCCTAGTATACGT 60.091 50.000 5.73 0.00 34.31 3.57
138 139 2.930040 CCGTGACTCATGTGTGGTATTC 59.070 50.000 4.90 0.00 0.00 1.75
222 223 2.611225 AGGTTTTGCCAAAAATGCGA 57.389 40.000 3.79 0.00 37.59 5.10
239 240 2.544267 AGCTGAAAACGAAGACGAAAGG 59.456 45.455 0.00 0.00 42.66 3.11
328 1364 6.473455 CGATAAACCAGAAAAAGATGGATTGC 59.527 38.462 0.00 0.00 39.02 3.56
623 1659 4.471386 AGGATCCTCCAGAATCTTTTCGAA 59.529 41.667 9.02 0.00 39.61 3.71
862 1898 4.773674 AGTTGATGAGAAAATTCATGGGCA 59.226 37.500 0.00 0.00 37.90 5.36
917 1953 5.123979 CCCTTTGAGCAACCTGTTCTAATAC 59.876 44.000 0.00 0.00 0.00 1.89
956 1992 5.534654 CCCGGGAAAAGCAGAATATTTGATA 59.465 40.000 18.48 0.00 0.00 2.15
1357 2394 3.362014 CGTTAGCGATGTGAAATGGATCG 60.362 47.826 0.00 0.00 41.51 3.69
1374 2411 1.810030 GTGGAAGAGGGCGCGTTAG 60.810 63.158 8.43 0.00 0.00 2.34
1491 2528 6.481434 AGGTAAATTAACGCCTCAGATAGT 57.519 37.500 0.00 0.00 0.00 2.12
1539 2576 3.370633 GGAGTTGTTAGGTTGGGATCCTC 60.371 52.174 12.58 2.25 36.60 3.71
1658 2695 6.238842 CCTCTTTTCACATGCGGAAATATGAT 60.239 38.462 12.34 0.00 34.50 2.45
1992 3029 6.749036 AGATTCGAGGGTTTCCATTATAGT 57.251 37.500 0.00 0.00 34.83 2.12
2060 3097 1.270358 GCAGTTCCACTTTCTCGGTCT 60.270 52.381 0.00 0.00 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.