Multiple sequence alignment - TraesCS5D01G220700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G220700 chr5D 100.000 2116 0 0 1 2116 329131696 329133811 0.000000e+00 3908
1 TraesCS5D01G220700 chr2D 97.360 2121 26 7 1 2116 628285675 628283580 0.000000e+00 3579
2 TraesCS5D01G220700 chr2D 96.910 1974 43 10 1 1971 334225930 334223972 0.000000e+00 3291
3 TraesCS5D01G220700 chr1D 97.217 2120 39 6 1 2116 254489709 254487606 0.000000e+00 3570
4 TraesCS5D01G220700 chr1D 94.395 1891 72 12 231 2116 244401944 244400083 0.000000e+00 2874
5 TraesCS5D01G220700 chr1D 97.498 1359 22 5 1 1355 394178920 394177570 0.000000e+00 2311
6 TraesCS5D01G220700 chr6D 97.218 2121 31 9 1 2116 431400034 431397937 0.000000e+00 3565
7 TraesCS5D01G220700 chr3D 96.791 2119 42 8 1 2116 21897562 21895467 0.000000e+00 3513
8 TraesCS5D01G220700 chr3B 96.613 2126 47 9 1 2116 201506586 201504476 0.000000e+00 3504
9 TraesCS5D01G220700 chr3B 94.326 141 5 3 399 537 21016929 21017068 1.640000e-51 213
10 TraesCS5D01G220700 chr2A 96.557 2120 60 6 1 2116 276441066 276443176 0.000000e+00 3498
11 TraesCS5D01G220700 chr2A 96.036 2119 57 8 1 2116 335826287 335824193 0.000000e+00 3422
12 TraesCS5D01G220700 chr1A 96.834 1895 31 9 1 1891 256026159 256028028 0.000000e+00 3140
13 TraesCS5D01G220700 chrUn 97.372 723 11 2 1 722 317473181 317473896 0.000000e+00 1223
14 TraesCS5D01G220700 chr7D 95.200 625 25 4 1 622 88605595 88604973 0.000000e+00 983
15 TraesCS5D01G220700 chr2B 94.406 143 8 0 442 584 482854069 482853927 9.830000e-54 220


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G220700 chr5D 329131696 329133811 2115 False 3908 3908 100.000 1 2116 1 chr5D.!!$F1 2115
1 TraesCS5D01G220700 chr2D 628283580 628285675 2095 True 3579 3579 97.360 1 2116 1 chr2D.!!$R2 2115
2 TraesCS5D01G220700 chr2D 334223972 334225930 1958 True 3291 3291 96.910 1 1971 1 chr2D.!!$R1 1970
3 TraesCS5D01G220700 chr1D 254487606 254489709 2103 True 3570 3570 97.217 1 2116 1 chr1D.!!$R2 2115
4 TraesCS5D01G220700 chr1D 244400083 244401944 1861 True 2874 2874 94.395 231 2116 1 chr1D.!!$R1 1885
5 TraesCS5D01G220700 chr1D 394177570 394178920 1350 True 2311 2311 97.498 1 1355 1 chr1D.!!$R3 1354
6 TraesCS5D01G220700 chr6D 431397937 431400034 2097 True 3565 3565 97.218 1 2116 1 chr6D.!!$R1 2115
7 TraesCS5D01G220700 chr3D 21895467 21897562 2095 True 3513 3513 96.791 1 2116 1 chr3D.!!$R1 2115
8 TraesCS5D01G220700 chr3B 201504476 201506586 2110 True 3504 3504 96.613 1 2116 1 chr3B.!!$R1 2115
9 TraesCS5D01G220700 chr2A 276441066 276443176 2110 False 3498 3498 96.557 1 2116 1 chr2A.!!$F1 2115
10 TraesCS5D01G220700 chr2A 335824193 335826287 2094 True 3422 3422 96.036 1 2116 1 chr2A.!!$R1 2115
11 TraesCS5D01G220700 chr1A 256026159 256028028 1869 False 3140 3140 96.834 1 1891 1 chr1A.!!$F1 1890
12 TraesCS5D01G220700 chrUn 317473181 317473896 715 False 1223 1223 97.372 1 722 1 chrUn.!!$F1 721
13 TraesCS5D01G220700 chr7D 88604973 88605595 622 True 983 983 95.200 1 622 1 chr7D.!!$R1 621

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
482 487 5.199982 TGGGGTTTTCTATTGATGCCTTA 57.8 39.13 0.0 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1507 1550 4.194678 TCTGGTCCCTCCGATTACTATT 57.805 45.455 0.0 0.0 39.52 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
482 487 5.199982 TGGGGTTTTCTATTGATGCCTTA 57.800 39.130 0.00 0.00 0.00 2.69
941 979 6.117488 ACAAGGAATTCCGTTAATAACCGAT 58.883 36.000 18.82 0.00 42.08 4.18
983 1021 9.302345 GAACAACTCGATGAATTTAGTAGATCA 57.698 33.333 0.00 0.00 0.00 2.92
985 1023 9.469807 ACAACTCGATGAATTTAGTAGATCATC 57.530 33.333 0.00 4.87 42.91 2.92
1051 1089 0.816825 AGTGCGATGGCTGGCTATTG 60.817 55.000 0.15 2.37 40.82 1.90
1113 1152 3.093814 TCAGCAATGCAGTTCATCCAAT 58.906 40.909 8.35 0.00 33.40 3.16
1158 1197 6.126863 AGAACTATGACAGAATCAAACCCA 57.873 37.500 0.00 0.00 41.93 4.51
1352 1392 4.973168 TGTTTTTGTCTCTAGCATGACCT 58.027 39.130 0.00 0.00 32.67 3.85
1502 1545 7.513781 TCATATTCTGGATTGGGTTCATCTCTA 59.486 37.037 0.00 0.00 0.00 2.43
1503 1546 6.776887 ATTCTGGATTGGGTTCATCTCTAT 57.223 37.500 0.00 0.00 0.00 1.98
1504 1547 7.878621 ATTCTGGATTGGGTTCATCTCTATA 57.121 36.000 0.00 0.00 0.00 1.31
1505 1548 6.924913 TCTGGATTGGGTTCATCTCTATAG 57.075 41.667 0.00 0.00 0.00 1.31
1506 1549 6.385443 TCTGGATTGGGTTCATCTCTATAGT 58.615 40.000 0.00 0.00 0.00 2.12
1507 1550 7.535738 TCTGGATTGGGTTCATCTCTATAGTA 58.464 38.462 0.00 0.00 0.00 1.82
1684 1727 5.066968 AGAAAAAGAGATCACTCGAGGAC 57.933 43.478 18.41 4.93 46.64 3.85
1992 2050 3.933332 CCAAGAGACAGACCCGAATAAAC 59.067 47.826 0.00 0.00 0.00 2.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
11 12 9.401058 CTTTTGTTCTCCTCTTATTCCATATGT 57.599 33.333 1.24 0.00 0.00 2.29
179 183 6.818644 CGAGATGAAATAGGGAAAGACAGAAA 59.181 38.462 0.00 0.00 0.00 2.52
526 563 7.062488 GCGTGGTTCCGAAACATAATTATTTTT 59.938 33.333 8.91 8.91 37.10 1.94
527 564 6.528774 GCGTGGTTCCGAAACATAATTATTTT 59.471 34.615 1.33 0.97 37.10 1.82
528 565 6.031471 GCGTGGTTCCGAAACATAATTATTT 58.969 36.000 1.33 0.00 37.10 1.40
680 718 6.693315 GGAATTGATTCCGTAAAAGATGGA 57.307 37.500 6.98 0.00 46.01 3.41
941 979 7.223193 TCGAGTTGTTCTAAAGAATCAAAACGA 59.777 33.333 18.64 18.64 35.73 3.85
983 1021 2.708325 GTCATTGAGGGCCTCCTAAGAT 59.292 50.000 30.03 13.23 45.05 2.40
985 1023 1.141858 GGTCATTGAGGGCCTCCTAAG 59.858 57.143 30.03 17.00 45.05 2.18
1051 1089 2.613133 CAGTAGGTACAGCTAGTCCGTC 59.387 54.545 0.00 0.00 0.00 4.79
1147 1186 7.929159 ACATTTTGTTCATTTGGGTTTGATTC 58.071 30.769 0.00 0.00 0.00 2.52
1352 1392 9.627123 CCTACTTTCCTCCACATTTTATCAATA 57.373 33.333 0.00 0.00 0.00 1.90
1502 1545 6.797707 TGGTCCCTCCGATTACTATTACTAT 58.202 40.000 0.00 0.00 39.52 2.12
1503 1546 6.044754 TCTGGTCCCTCCGATTACTATTACTA 59.955 42.308 0.00 0.00 39.52 1.82
1504 1547 5.070823 TGGTCCCTCCGATTACTATTACT 57.929 43.478 0.00 0.00 39.52 2.24
1505 1548 5.075493 TCTGGTCCCTCCGATTACTATTAC 58.925 45.833 0.00 0.00 39.52 1.89
1506 1549 5.329191 TCTGGTCCCTCCGATTACTATTA 57.671 43.478 0.00 0.00 39.52 0.98
1507 1550 4.194678 TCTGGTCCCTCCGATTACTATT 57.805 45.455 0.00 0.00 39.52 1.73
1575 1618 5.465935 GTCCTTTCCGCTCTAATCAGATAG 58.534 45.833 0.00 0.00 0.00 2.08
1684 1727 5.865085 TCCTTCGTGGAATAAGATATTGGG 58.135 41.667 0.00 0.00 42.94 4.12
1794 1839 8.990163 AAGTAAACTCTTCCATTGAAGGTTTA 57.010 30.769 18.72 18.72 46.61 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.