Multiple sequence alignment - TraesCS5D01G220600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G220600 chr5D 100.000 2252 0 0 1 2252 329131434 329133685 0.000000e+00 4159
1 TraesCS5D01G220600 chr6D 97.344 2259 34 9 1 2252 431400298 431398059 0.000000e+00 3816
2 TraesCS5D01G220600 chr1D 97.298 2258 39 7 1 2252 254489973 254487732 0.000000e+00 3812
3 TraesCS5D01G220600 chr1D 97.474 1623 27 6 1 1617 394179184 394177570 0.000000e+00 2758
4 TraesCS5D01G220600 chr1D 94.278 1765 67 12 493 2252 244401944 244400209 0.000000e+00 2669
5 TraesCS5D01G220600 chr2D 97.257 2260 29 8 1 2252 628285940 628283706 0.000000e+00 3799
6 TraesCS5D01G220600 chr2D 96.603 2237 57 11 1 2233 334226193 334223972 0.000000e+00 3692
7 TraesCS5D01G220600 chr3D 96.767 2258 44 9 1 2252 21897827 21895593 0.000000e+00 3738
8 TraesCS5D01G220600 chr2A 96.101 2257 74 7 1 2252 276440803 276443050 0.000000e+00 3668
9 TraesCS5D01G220600 chr2A 95.658 2257 69 9 1 2252 335826551 335824319 0.000000e+00 3598
10 TraesCS5D01G220600 chr3B 96.067 2263 63 10 1 2252 201506849 201504602 0.000000e+00 3663
11 TraesCS5D01G220600 chrUn 97.267 988 16 3 1 984 317472916 317473896 0.000000e+00 1664
12 TraesCS5D01G220600 chr7D 96.933 163 5 0 1 163 231589512 231589350 7.920000e-70 274
13 TraesCS5D01G220600 chr7D 97.015 134 4 0 4 137 231595754 231595887 2.250000e-55 226


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G220600 chr5D 329131434 329133685 2251 False 4159 4159 100.000 1 2252 1 chr5D.!!$F1 2251
1 TraesCS5D01G220600 chr6D 431398059 431400298 2239 True 3816 3816 97.344 1 2252 1 chr6D.!!$R1 2251
2 TraesCS5D01G220600 chr1D 254487732 254489973 2241 True 3812 3812 97.298 1 2252 1 chr1D.!!$R2 2251
3 TraesCS5D01G220600 chr1D 394177570 394179184 1614 True 2758 2758 97.474 1 1617 1 chr1D.!!$R3 1616
4 TraesCS5D01G220600 chr1D 244400209 244401944 1735 True 2669 2669 94.278 493 2252 1 chr1D.!!$R1 1759
5 TraesCS5D01G220600 chr2D 628283706 628285940 2234 True 3799 3799 97.257 1 2252 1 chr2D.!!$R2 2251
6 TraesCS5D01G220600 chr2D 334223972 334226193 2221 True 3692 3692 96.603 1 2233 1 chr2D.!!$R1 2232
7 TraesCS5D01G220600 chr3D 21895593 21897827 2234 True 3738 3738 96.767 1 2252 1 chr3D.!!$R1 2251
8 TraesCS5D01G220600 chr2A 276440803 276443050 2247 False 3668 3668 96.101 1 2252 1 chr2A.!!$F1 2251
9 TraesCS5D01G220600 chr2A 335824319 335826551 2232 True 3598 3598 95.658 1 2252 1 chr2A.!!$R1 2251
10 TraesCS5D01G220600 chr3B 201504602 201506849 2247 True 3663 3663 96.067 1 2252 1 chr3B.!!$R1 2251
11 TraesCS5D01G220600 chrUn 317472916 317473896 980 False 1664 1664 97.267 1 984 1 chrUn.!!$F1 983

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
744 758 5.199982 TGGGGTTTTCTATTGATGCCTTA 57.8 39.13 0.0 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1769 1801 4.194678 TCTGGTCCCTCCGATTACTATT 57.805 45.455 0.0 0.0 39.52 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
40 41 9.286946 CTAATTCTGAATCAAGAGATTTGTTGC 57.713 33.333 2.92 0.00 44.30 4.17
50 51 5.200368 AGAGATTTGTTGCGGAATTTGTT 57.800 34.783 0.00 0.00 0.00 2.83
744 758 5.199982 TGGGGTTTTCTATTGATGCCTTA 57.800 39.130 0.00 0.00 0.00 2.69
1203 1233 6.117488 ACAAGGAATTCCGTTAATAACCGAT 58.883 36.000 18.82 0.00 42.08 4.18
1245 1275 9.302345 GAACAACTCGATGAATTTAGTAGATCA 57.698 33.333 0.00 0.00 0.00 2.92
1247 1277 9.469807 ACAACTCGATGAATTTAGTAGATCATC 57.530 33.333 0.00 4.87 42.91 2.92
1313 1343 0.816825 AGTGCGATGGCTGGCTATTG 60.817 55.000 0.15 2.37 40.82 1.90
1375 1406 3.093814 TCAGCAATGCAGTTCATCCAAT 58.906 40.909 8.35 0.00 33.40 3.16
1420 1451 6.126863 AGAACTATGACAGAATCAAACCCA 57.873 37.500 0.00 0.00 41.93 4.51
1614 1646 4.973168 TGTTTTTGTCTCTAGCATGACCT 58.027 39.130 0.00 0.00 32.67 3.85
1764 1796 7.513781 TCATATTCTGGATTGGGTTCATCTCTA 59.486 37.037 0.00 0.00 0.00 2.43
1765 1797 6.776887 ATTCTGGATTGGGTTCATCTCTAT 57.223 37.500 0.00 0.00 0.00 1.98
1766 1798 7.878621 ATTCTGGATTGGGTTCATCTCTATA 57.121 36.000 0.00 0.00 0.00 1.31
1767 1799 6.924913 TCTGGATTGGGTTCATCTCTATAG 57.075 41.667 0.00 0.00 0.00 1.31
1768 1800 6.385443 TCTGGATTGGGTTCATCTCTATAGT 58.615 40.000 0.00 0.00 0.00 2.12
1769 1801 7.535738 TCTGGATTGGGTTCATCTCTATAGTA 58.464 38.462 0.00 0.00 0.00 1.82
1946 1978 5.066968 AGAAAAAGAGATCACTCGAGGAC 57.933 43.478 18.41 4.93 46.64 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
273 279 9.401058 CTTTTGTTCTCCTCTTATTCCATATGT 57.599 33.333 1.24 0.00 0.00 2.29
333 340 8.470657 AAGTAAATTCAAGGAAGAGCTTTCTT 57.529 30.769 0.00 0.00 38.89 2.52
334 341 8.470657 AAAGTAAATTCAAGGAAGAGCTTTCT 57.529 30.769 0.00 0.00 0.00 2.52
441 454 6.818644 CGAGATGAAATAGGGAAAGACAGAAA 59.181 38.462 0.00 0.00 0.00 2.52
788 817 7.062488 GCGTGGTTCCGAAACATAATTATTTTT 59.938 33.333 8.91 8.91 37.10 1.94
789 818 6.528774 GCGTGGTTCCGAAACATAATTATTTT 59.471 34.615 1.33 0.97 37.10 1.82
790 819 6.031471 GCGTGGTTCCGAAACATAATTATTT 58.969 36.000 1.33 0.00 37.10 1.40
791 820 5.124138 TGCGTGGTTCCGAAACATAATTATT 59.876 36.000 1.33 0.00 37.10 1.40
792 821 4.636648 TGCGTGGTTCCGAAACATAATTAT 59.363 37.500 1.33 0.00 37.10 1.28
942 972 6.693315 GGAATTGATTCCGTAAAAGATGGA 57.307 37.500 6.98 0.00 46.01 3.41
1203 1233 7.223193 TCGAGTTGTTCTAAAGAATCAAAACGA 59.777 33.333 18.64 18.64 35.73 3.85
1245 1275 2.708325 GTCATTGAGGGCCTCCTAAGAT 59.292 50.000 30.03 13.23 45.05 2.40
1247 1277 1.141858 GGTCATTGAGGGCCTCCTAAG 59.858 57.143 30.03 17.00 45.05 2.18
1313 1343 2.613133 CAGTAGGTACAGCTAGTCCGTC 59.387 54.545 0.00 0.00 0.00 4.79
1409 1440 7.929159 ACATTTTGTTCATTTGGGTTTGATTC 58.071 30.769 0.00 0.00 0.00 2.52
1614 1646 9.627123 CCTACTTTCCTCCACATTTTATCAATA 57.373 33.333 0.00 0.00 0.00 1.90
1764 1796 6.797707 TGGTCCCTCCGATTACTATTACTAT 58.202 40.000 0.00 0.00 39.52 2.12
1765 1797 6.044754 TCTGGTCCCTCCGATTACTATTACTA 59.955 42.308 0.00 0.00 39.52 1.82
1766 1798 5.070823 TGGTCCCTCCGATTACTATTACT 57.929 43.478 0.00 0.00 39.52 2.24
1767 1799 5.075493 TCTGGTCCCTCCGATTACTATTAC 58.925 45.833 0.00 0.00 39.52 1.89
1768 1800 5.329191 TCTGGTCCCTCCGATTACTATTA 57.671 43.478 0.00 0.00 39.52 0.98
1769 1801 4.194678 TCTGGTCCCTCCGATTACTATT 57.805 45.455 0.00 0.00 39.52 1.73
1837 1869 5.465935 GTCCTTTCCGCTCTAATCAGATAG 58.534 45.833 0.00 0.00 0.00 2.08
1946 1978 5.865085 TCCTTCGTGGAATAAGATATTGGG 58.135 41.667 0.00 0.00 42.94 4.12
2055 2090 9.588096 AAGTAAACTCTTCCATTGAAGGTTTAT 57.412 29.630 22.01 13.04 46.61 1.40
2056 2091 8.990163 AAGTAAACTCTTCCATTGAAGGTTTA 57.010 30.769 18.72 18.72 46.61 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.