Multiple sequence alignment - TraesCS5D01G220300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G220300 chr5D 100.000 2174 0 0 1 2174 329125917 329128090 0 4015
1 TraesCS5D01G220300 chr5D 96.549 2202 40 8 1 2174 503339430 503337237 0 3613
2 TraesCS5D01G220300 chr5D 96.498 2199 37 8 1 2174 6253286 6255469 0 3598
3 TraesCS5D01G220300 chr5D 96.184 2201 47 10 1 2174 503313492 503311302 0 3565
4 TraesCS5D01G220300 chr5D 96.337 1720 28 7 481 2174 481597269 481595559 0 2795
5 TraesCS5D01G220300 chr5D 96.494 1141 15 4 1059 2174 481593899 481592759 0 1862
6 TraesCS5D01G220300 chr3A 96.422 2208 35 11 1 2174 105556967 105559164 0 3600
7 TraesCS5D01G220300 chr1D 96.360 2198 47 8 1 2174 51831970 51834158 0 3585
8 TraesCS5D01G220300 chr1D 95.765 2196 41 11 1 2174 254459398 254457233 0 3493
9 TraesCS5D01G220300 chr1D 96.407 1141 16 4 1059 2174 254455573 254454433 0 1857
10 TraesCS5D01G220300 chr1D 96.289 1078 15 4 1122 2174 254455569 254456646 0 1746
11 TraesCS5D01G220300 chr1B 96.364 2200 43 10 1 2174 633716961 633714773 0 3585
12 TraesCS5D01G220300 chr3B 96.609 2123 32 10 1 2093 101924866 101922754 0 3485
13 TraesCS5D01G220300 chr7B 96.322 2039 38 9 1 2013 662755045 662757072 0 3315
14 TraesCS5D01G220300 chr1A 96.225 2040 40 8 162 2174 554482083 554480054 0 3306
15 TraesCS5D01G220300 chrUn 95.588 748 11 3 1449 2174 433906545 433905798 0 1179


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G220300 chr5D 329125917 329128090 2173 False 4015.0 4015 100.0000 1 2174 1 chr5D.!!$F2 2173
1 TraesCS5D01G220300 chr5D 503337237 503339430 2193 True 3613.0 3613 96.5490 1 2174 1 chr5D.!!$R2 2173
2 TraesCS5D01G220300 chr5D 6253286 6255469 2183 False 3598.0 3598 96.4980 1 2174 1 chr5D.!!$F1 2173
3 TraesCS5D01G220300 chr5D 503311302 503313492 2190 True 3565.0 3565 96.1840 1 2174 1 chr5D.!!$R1 2173
4 TraesCS5D01G220300 chr5D 481592759 481597269 4510 True 2328.5 2795 96.4155 481 2174 2 chr5D.!!$R3 1693
5 TraesCS5D01G220300 chr3A 105556967 105559164 2197 False 3600.0 3600 96.4220 1 2174 1 chr3A.!!$F1 2173
6 TraesCS5D01G220300 chr1D 51831970 51834158 2188 False 3585.0 3585 96.3600 1 2174 1 chr1D.!!$F1 2173
7 TraesCS5D01G220300 chr1D 254454433 254459398 4965 True 2675.0 3493 96.0860 1 2174 2 chr1D.!!$R1 2173
8 TraesCS5D01G220300 chr1D 254455569 254456646 1077 False 1746.0 1746 96.2890 1122 2174 1 chr1D.!!$F2 1052
9 TraesCS5D01G220300 chr1B 633714773 633716961 2188 True 3585.0 3585 96.3640 1 2174 1 chr1B.!!$R1 2173
10 TraesCS5D01G220300 chr3B 101922754 101924866 2112 True 3485.0 3485 96.6090 1 2093 1 chr3B.!!$R1 2092
11 TraesCS5D01G220300 chr7B 662755045 662757072 2027 False 3315.0 3315 96.3220 1 2013 1 chr7B.!!$F1 2012
12 TraesCS5D01G220300 chr1A 554480054 554482083 2029 True 3306.0 3306 96.2250 162 2174 1 chr1A.!!$R1 2012
13 TraesCS5D01G220300 chrUn 433905798 433906545 747 True 1179.0 1179 95.5880 1449 2174 1 chrUn.!!$R1 725

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
310 318 2.229543 CCAGCAGCAATAACAGAAGCAA 59.77 45.455 0.0 0.0 0.0 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1452 7060 2.654863 GAATCCACAAACCATCCCGAT 58.345 47.619 0.0 0.0 0.0 4.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
171 179 7.466590 GCTTCCATAAAAGCTAGACTAAGCAAG 60.467 40.741 0.00 0.0 46.51 4.01
310 318 2.229543 CCAGCAGCAATAACAGAAGCAA 59.770 45.455 0.00 0.0 0.00 3.91
846 866 6.832520 TTTTGCAACCAAGCAGATTATCTA 57.167 33.333 0.00 0.0 46.54 1.98
876 896 3.692576 CATGAATTGAGCTAAGCTGCAC 58.307 45.455 1.02 0.0 39.88 4.57
1049 1075 7.417456 GGGGACTAAAGAAACAAGAACAACAAT 60.417 37.037 0.00 0.0 0.00 2.71
1134 6741 9.396022 GTGAAATCTTCTAGGATGTTAATTGGA 57.604 33.333 0.00 0.0 0.00 3.53
1264 6871 7.817478 CAGTAGTATTTATATCATTCGTGGGCA 59.183 37.037 0.00 0.0 0.00 5.36
1424 7032 6.767902 TGCTCAAGTCTCAAATAAACTCAAGT 59.232 34.615 0.00 0.0 0.00 3.16
1887 7532 4.082026 GCAGTTGCCCAAGAATTCACTATT 60.082 41.667 8.44 0.0 34.31 1.73
1925 7570 7.818642 ACGATTTCTTATATAGAGAGAACGGG 58.181 38.462 13.67 4.1 33.51 5.28
2128 7773 1.806542 ACGATCACAATGTCTGGCAAC 59.193 47.619 0.00 0.0 0.00 4.17
2168 7813 1.739035 CGCCGAGATACCTTTGCAAGA 60.739 52.381 0.00 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
171 179 7.201504 GCAGAAGGTAAAATACGAGGTACTTTC 60.202 40.741 0.00 0.00 41.55 2.62
310 318 4.400251 CACCATGAATCCACTAATTGCTGT 59.600 41.667 0.00 0.00 0.00 4.40
709 728 0.842030 AAGGAGGGTGGAGTCATGCA 60.842 55.000 0.00 0.00 0.00 3.96
712 731 2.173569 GCATTAAGGAGGGTGGAGTCAT 59.826 50.000 0.00 0.00 0.00 3.06
846 866 3.362706 AGCTCAATTCATGCATGGTTCT 58.637 40.909 25.97 11.76 0.00 3.01
1049 1075 7.552687 GGAATATATTGGCGGATGAATTAGTCA 59.447 37.037 1.78 0.00 41.67 3.41
1452 7060 2.654863 GAATCCACAAACCATCCCGAT 58.345 47.619 0.00 0.00 0.00 4.18
1853 7498 4.792521 TGGGCAACTGCGTAAATTTATT 57.207 36.364 0.31 0.00 43.26 1.40
2017 7662 4.280436 AGTCGATACAAATTGTGACCCA 57.720 40.909 9.15 0.00 0.00 4.51
2128 7773 3.865745 GCGGGATCAAATATATGACGAGG 59.134 47.826 0.00 0.00 30.82 4.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.