Multiple sequence alignment - TraesCS5D01G220200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G220200 chr5D 100.000 2246 0 0 1 2246 329127246 329125001 0 4148
1 TraesCS5D01G220200 chr5D 97.825 1609 28 5 1 1604 6254618 6253012 0 2771
2 TraesCS5D01G220200 chr5D 97.201 1608 33 4 1 1604 503338105 503339704 0 2710
3 TraesCS5D01G220200 chr5D 96.826 1607 38 6 1 1604 503312170 503313766 0 2673
4 TraesCS5D01G220200 chr5D 98.098 631 7 3 1620 2246 560879258 560879887 0 1094
5 TraesCS5D01G220200 chr3B 97.267 1610 28 6 1 1604 101923541 101925140 0 2715
6 TraesCS5D01G220200 chr7B 97.201 1608 30 6 1 1604 662756367 662754771 0 2706
7 TraesCS5D01G220200 chr5B 97.145 1611 29 6 1 1604 57516461 57514861 0 2704
8 TraesCS5D01G220200 chr3A 97.086 1613 28 7 1 1604 105558295 105556693 0 2700
9 TraesCS5D01G220200 chr3A 98.246 627 9 1 1620 2246 672915546 672914922 0 1096
10 TraesCS5D01G220200 chr1B 97.015 1608 33 6 1 1604 633715639 633717235 0 2689
11 TraesCS5D01G220200 chr1D 96.951 1607 37 5 1 1604 51833293 51831696 0 2686
12 TraesCS5D01G220200 chr1D 98.254 630 8 2 1620 2246 144237496 144238125 0 1099
13 TraesCS5D01G220200 chr2D 98.567 628 8 1 1620 2246 272799442 272798815 0 1109
14 TraesCS5D01G220200 chrUn 98.413 630 7 2 1620 2246 93417558 93416929 0 1105
15 TraesCS5D01G220200 chrUn 98.712 621 7 1 1620 2239 327661088 327660468 0 1101
16 TraesCS5D01G220200 chr6D 98.408 628 8 2 1620 2246 168245995 168246621 0 1103
17 TraesCS5D01G220200 chr6A 97.930 628 11 2 1620 2246 271184239 271184865 0 1086
18 TraesCS5D01G220200 chr4A 97.927 627 13 0 1620 2246 722780099 722779473 0 1086


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G220200 chr5D 329125001 329127246 2245 True 4148 4148 100.000 1 2246 1 chr5D.!!$R2 2245
1 TraesCS5D01G220200 chr5D 6253012 6254618 1606 True 2771 2771 97.825 1 1604 1 chr5D.!!$R1 1603
2 TraesCS5D01G220200 chr5D 503338105 503339704 1599 False 2710 2710 97.201 1 1604 1 chr5D.!!$F2 1603
3 TraesCS5D01G220200 chr5D 503312170 503313766 1596 False 2673 2673 96.826 1 1604 1 chr5D.!!$F1 1603
4 TraesCS5D01G220200 chr5D 560879258 560879887 629 False 1094 1094 98.098 1620 2246 1 chr5D.!!$F3 626
5 TraesCS5D01G220200 chr3B 101923541 101925140 1599 False 2715 2715 97.267 1 1604 1 chr3B.!!$F1 1603
6 TraesCS5D01G220200 chr7B 662754771 662756367 1596 True 2706 2706 97.201 1 1604 1 chr7B.!!$R1 1603
7 TraesCS5D01G220200 chr5B 57514861 57516461 1600 True 2704 2704 97.145 1 1604 1 chr5B.!!$R1 1603
8 TraesCS5D01G220200 chr3A 105556693 105558295 1602 True 2700 2700 97.086 1 1604 1 chr3A.!!$R1 1603
9 TraesCS5D01G220200 chr3A 672914922 672915546 624 True 1096 1096 98.246 1620 2246 1 chr3A.!!$R2 626
10 TraesCS5D01G220200 chr1B 633715639 633717235 1596 False 2689 2689 97.015 1 1604 1 chr1B.!!$F1 1603
11 TraesCS5D01G220200 chr1D 51831696 51833293 1597 True 2686 2686 96.951 1 1604 1 chr1D.!!$R1 1603
12 TraesCS5D01G220200 chr1D 144237496 144238125 629 False 1099 1099 98.254 1620 2246 1 chr1D.!!$F1 626
13 TraesCS5D01G220200 chr2D 272798815 272799442 627 True 1109 1109 98.567 1620 2246 1 chr2D.!!$R1 626
14 TraesCS5D01G220200 chrUn 93416929 93417558 629 True 1105 1105 98.413 1620 2246 1 chrUn.!!$R1 626
15 TraesCS5D01G220200 chrUn 327660468 327661088 620 True 1101 1101 98.712 1620 2239 1 chrUn.!!$R2 619
16 TraesCS5D01G220200 chr6D 168245995 168246621 626 False 1103 1103 98.408 1620 2246 1 chr6D.!!$F1 626
17 TraesCS5D01G220200 chr6A 271184239 271184865 626 False 1086 1086 97.930 1620 2246 1 chr6A.!!$F1 626
18 TraesCS5D01G220200 chr4A 722779473 722780099 626 True 1086 1086 97.927 1620 2246 1 chr4A.!!$R1 626

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
620 629 0.84203 AAGGAGGGTGGAGTCATGCA 60.842 55.0 0.0 0.0 0.0 3.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1816 1848 1.452953 CGCCCCGTCTATAGTGCTCA 61.453 60.0 0.0 0.0 0.0 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
280 281 7.552687 GGAATATATTGGCGGATGAATTAGTCA 59.447 37.037 1.78 0.00 41.67 3.41
483 491 3.362706 AGCTCAATTCATGCATGGTTCT 58.637 40.909 25.97 11.76 0.00 3.01
617 626 2.173569 GCATTAAGGAGGGTGGAGTCAT 59.826 50.000 0.00 0.00 0.00 3.06
620 629 0.842030 AAGGAGGGTGGAGTCATGCA 60.842 55.000 0.00 0.00 0.00 3.96
1019 1036 4.400251 CACCATGAATCCACTAATTGCTGT 59.600 41.667 0.00 0.00 0.00 4.40
1158 1179 7.201504 GCAGAAGGTAAAATACGAGGTACTTTC 60.202 40.741 0.00 0.00 41.55 2.62
1461 1489 8.713036 AGAAGATATGCTCACCTTCTTATTTCT 58.287 33.333 0.00 0.00 41.61 2.52
1549 1577 4.875544 TCAACAAAGGAAGTCTTTCACG 57.124 40.909 0.00 0.00 43.32 4.35
1615 1643 8.345724 AGATTGAATCTATTATGGTTCATGGC 57.654 34.615 5.78 0.00 38.00 4.40
1616 1644 8.168725 AGATTGAATCTATTATGGTTCATGGCT 58.831 33.333 5.78 0.00 38.00 4.75
1617 1645 8.716674 ATTGAATCTATTATGGTTCATGGCTT 57.283 30.769 0.00 0.00 31.39 4.35
1618 1646 7.514784 TGAATCTATTATGGTTCATGGCTTG 57.485 36.000 0.00 0.00 0.00 4.01
1727 1755 2.742589 GTTACTTTTGCTTCTCTCGGGG 59.257 50.000 0.00 0.00 0.00 5.73
1816 1848 6.441088 AATAGGAAGGGCGAGATAGAATTT 57.559 37.500 0.00 0.00 0.00 1.82
1828 1860 7.309177 GCGAGATAGAATTTGAGCACTATAGA 58.691 38.462 6.78 0.00 0.00 1.98
2083 2116 8.020819 CGCAAAGTTGAAACCAAGAAATATCTA 58.979 33.333 0.00 0.00 33.77 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
65 66 7.817478 CAGTAGTATTTATATCATTCGTGGGCA 59.183 37.037 0.00 0.0 0.00 5.36
195 196 9.396022 GTGAAATCTTCTAGGATGTTAATTGGA 57.604 33.333 0.00 0.0 0.00 3.53
280 281 7.417456 GGGGACTAAAGAAACAAGAACAACAAT 60.417 37.037 0.00 0.0 0.00 2.71
453 461 3.692576 CATGAATTGAGCTAAGCTGCAC 58.307 45.455 1.02 0.0 39.88 4.57
483 491 6.832520 TTTTGCAACCAAGCAGATTATCTA 57.167 33.333 0.00 0.0 46.54 1.98
1019 1036 2.229543 CCAGCAGCAATAACAGAAGCAA 59.770 45.455 0.00 0.0 0.00 3.91
1158 1179 7.466590 GCTTCCATAAAAGCTAGACTAAGCAAG 60.467 40.741 0.00 0.0 46.51 4.01
1461 1489 4.834496 TCCACTTTCCTAAACTAAGGACGA 59.166 41.667 0.00 0.0 45.49 4.20
1549 1577 3.725490 AGTCTTACGTCTTGTTTGACCC 58.275 45.455 0.00 0.0 34.30 4.46
1604 1632 5.244626 GCTATATTTCCAAGCCATGAACCAT 59.755 40.000 0.00 0.0 0.00 3.55
1605 1633 4.584325 GCTATATTTCCAAGCCATGAACCA 59.416 41.667 0.00 0.0 0.00 3.67
1606 1634 5.126396 GCTATATTTCCAAGCCATGAACC 57.874 43.478 0.00 0.0 0.00 3.62
1614 1642 6.054860 TCATCCTAGGCTATATTTCCAAGC 57.945 41.667 2.96 0.0 35.47 4.01
1615 1643 7.052873 CCATCATCCTAGGCTATATTTCCAAG 58.947 42.308 2.96 0.0 0.00 3.61
1616 1644 6.505344 ACCATCATCCTAGGCTATATTTCCAA 59.495 38.462 2.96 0.0 0.00 3.53
1617 1645 6.032039 ACCATCATCCTAGGCTATATTTCCA 58.968 40.000 2.96 0.0 0.00 3.53
1618 1646 6.069963 ACACCATCATCCTAGGCTATATTTCC 60.070 42.308 2.96 0.0 0.00 3.13
1816 1848 1.452953 CGCCCCGTCTATAGTGCTCA 61.453 60.000 0.00 0.0 0.00 4.26
1828 1860 4.467082 TGTTATATATGGTAATCGCCCCGT 59.533 41.667 0.00 0.0 0.00 5.28
2083 2116 4.196626 TCGGAAACATCAGGAACGTAAT 57.803 40.909 0.00 0.0 0.00 1.89


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.