Multiple sequence alignment - TraesCS5D01G215900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G215900 chr5D 100.000 2549 0 0 1 2549 324808721 324811269 0.000000e+00 4708
1 TraesCS5D01G215900 chr5D 96.922 2014 55 4 537 2549 336311006 336308999 0.000000e+00 3369
2 TraesCS5D01G215900 chr5D 96.731 2019 56 10 539 2549 482332203 482330187 0.000000e+00 3354
3 TraesCS5D01G215900 chr5D 96.801 1688 42 11 868 2549 336262918 336264599 0.000000e+00 2808
4 TraesCS5D01G215900 chr5D 96.654 538 18 0 1 538 97971408 97970871 0.000000e+00 894
5 TraesCS5D01G215900 chr5D 96.283 538 20 0 1 538 350287586 350288123 0.000000e+00 883
6 TraesCS5D01G215900 chr5D 96.097 538 21 0 1 538 175643574 175644111 0.000000e+00 878
7 TraesCS5D01G215900 chr5D 97.007 401 8 2 539 939 336262624 336263020 0.000000e+00 671
8 TraesCS5D01G215900 chr7D 96.276 2041 39 6 539 2549 113991310 113993343 0.000000e+00 3314
9 TraesCS5D01G215900 chr7D 96.623 533 18 0 6 538 620972370 620971838 0.000000e+00 885
10 TraesCS5D01G215900 chr7A 95.045 2018 89 9 538 2549 14473100 14471088 0.000000e+00 3162
11 TraesCS5D01G215900 chr2D 94.888 2015 66 10 537 2549 647705356 647707335 0.000000e+00 3116
12 TraesCS5D01G215900 chr2D 97.987 1639 29 3 912 2549 498471319 498469684 0.000000e+00 2841
13 TraesCS5D01G215900 chr2D 96.097 538 21 0 1 538 69696649 69697186 0.000000e+00 878
14 TraesCS5D01G215900 chr2D 95.610 410 14 1 539 944 238958886 238959295 0.000000e+00 654
15 TraesCS5D01G215900 chr6D 97.394 1650 35 4 901 2549 52521415 52519773 0.000000e+00 2802
16 TraesCS5D01G215900 chr6D 96.627 1690 47 10 865 2549 109963503 109965187 0.000000e+00 2796
17 TraesCS5D01G215900 chr6D 96.097 538 21 0 1 538 31372631 31372094 0.000000e+00 878
18 TraesCS5D01G215900 chr3D 96.468 538 19 0 1 538 344969929 344969392 0.000000e+00 889
19 TraesCS5D01G215900 chr3D 96.283 538 17 2 1 538 549257677 549258211 0.000000e+00 880
20 TraesCS5D01G215900 chr3D 96.097 538 21 0 1 538 236950799 236950262 0.000000e+00 878
21 TraesCS5D01G215900 chr1D 96.278 403 11 1 537 939 26486136 26486534 0.000000e+00 658
22 TraesCS5D01G215900 chr1A 94.608 408 20 1 537 942 16895687 16895280 4.630000e-177 630
23 TraesCS5D01G215900 chr4A 94.404 411 19 3 533 942 603147225 603146818 1.660000e-176 628


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G215900 chr5D 324808721 324811269 2548 False 4708.0 4708 100.000 1 2549 1 chr5D.!!$F2 2548
1 TraesCS5D01G215900 chr5D 336308999 336311006 2007 True 3369.0 3369 96.922 537 2549 1 chr5D.!!$R2 2012
2 TraesCS5D01G215900 chr5D 482330187 482332203 2016 True 3354.0 3354 96.731 539 2549 1 chr5D.!!$R3 2010
3 TraesCS5D01G215900 chr5D 336262624 336264599 1975 False 1739.5 2808 96.904 539 2549 2 chr5D.!!$F4 2010
4 TraesCS5D01G215900 chr5D 97970871 97971408 537 True 894.0 894 96.654 1 538 1 chr5D.!!$R1 537
5 TraesCS5D01G215900 chr5D 350287586 350288123 537 False 883.0 883 96.283 1 538 1 chr5D.!!$F3 537
6 TraesCS5D01G215900 chr5D 175643574 175644111 537 False 878.0 878 96.097 1 538 1 chr5D.!!$F1 537
7 TraesCS5D01G215900 chr7D 113991310 113993343 2033 False 3314.0 3314 96.276 539 2549 1 chr7D.!!$F1 2010
8 TraesCS5D01G215900 chr7D 620971838 620972370 532 True 885.0 885 96.623 6 538 1 chr7D.!!$R1 532
9 TraesCS5D01G215900 chr7A 14471088 14473100 2012 True 3162.0 3162 95.045 538 2549 1 chr7A.!!$R1 2011
10 TraesCS5D01G215900 chr2D 647705356 647707335 1979 False 3116.0 3116 94.888 537 2549 1 chr2D.!!$F3 2012
11 TraesCS5D01G215900 chr2D 498469684 498471319 1635 True 2841.0 2841 97.987 912 2549 1 chr2D.!!$R1 1637
12 TraesCS5D01G215900 chr2D 69696649 69697186 537 False 878.0 878 96.097 1 538 1 chr2D.!!$F1 537
13 TraesCS5D01G215900 chr6D 52519773 52521415 1642 True 2802.0 2802 97.394 901 2549 1 chr6D.!!$R2 1648
14 TraesCS5D01G215900 chr6D 109963503 109965187 1684 False 2796.0 2796 96.627 865 2549 1 chr6D.!!$F1 1684
15 TraesCS5D01G215900 chr6D 31372094 31372631 537 True 878.0 878 96.097 1 538 1 chr6D.!!$R1 537
16 TraesCS5D01G215900 chr3D 344969392 344969929 537 True 889.0 889 96.468 1 538 1 chr3D.!!$R2 537
17 TraesCS5D01G215900 chr3D 549257677 549258211 534 False 880.0 880 96.283 1 538 1 chr3D.!!$F1 537
18 TraesCS5D01G215900 chr3D 236950262 236950799 537 True 878.0 878 96.097 1 538 1 chr3D.!!$R1 537

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
142 143 1.206371 GAATTCCAGCTGCCAGCATTT 59.794 47.619 20.53 4.46 45.56 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1794 1865 0.108662 GCAGTTGGCCCATTAGTTGC 60.109 55.0 0.0 0.0 36.11 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 4.507335 CCCTCTGGTTGATTCTTTCTCCAA 60.507 45.833 0.00 0.00 32.01 3.53
142 143 1.206371 GAATTCCAGCTGCCAGCATTT 59.794 47.619 20.53 4.46 45.56 2.32
196 197 7.675062 AGAGAGAATAGGCATAAGTATTGTGG 58.325 38.462 0.00 0.00 37.70 4.17
288 289 1.290134 CTCCCCCAAGCTTAGACCTT 58.710 55.000 0.00 0.00 0.00 3.50
476 477 6.990341 TCACAATGTCAAGTATGAATCAGG 57.010 37.500 0.00 0.00 37.30 3.86
525 526 5.427378 TGATCTCGGTCATTGAAGCAATTA 58.573 37.500 0.00 0.00 31.05 1.40
587 589 1.610522 GTCCATGTGCTCAGTTTTGCT 59.389 47.619 0.00 0.00 0.00 3.91
666 668 2.143594 AACTCAGCCGTCTCCGTCAC 62.144 60.000 0.00 0.00 0.00 3.67
740 744 4.420168 CAATTTTATTCCGACCGTTGCAT 58.580 39.130 0.00 0.00 0.00 3.96
778 782 1.301716 GCAGAGAGCCGTTGACCAA 60.302 57.895 0.00 0.00 37.23 3.67
955 1025 2.202946 GCGGTGGGAAGCTAGCTC 60.203 66.667 19.65 11.44 0.00 4.09
1021 1091 1.913262 TCTTCCTCAAGCTCCCGCA 60.913 57.895 0.00 0.00 39.10 5.69
1263 1333 3.960102 TGACATGCTTCTTTCTTTGGGTT 59.040 39.130 0.00 0.00 0.00 4.11
1339 1409 3.422303 GCATGCTGCCACGAACGA 61.422 61.111 11.37 0.00 37.42 3.85
1782 1853 1.666189 GGCCAAATTCAGAGCGTAGAC 59.334 52.381 0.00 0.00 0.00 2.59
1848 1920 3.353836 CGGGGGTTCACTTGCGTG 61.354 66.667 0.00 0.00 42.59 5.34
2210 2285 0.184933 TTGTGGTGTTTAGGGCTGCT 59.815 50.000 0.00 0.00 0.00 4.24
2229 2304 1.822990 CTCTGGTAACCGCTAGGACAA 59.177 52.381 0.00 0.00 41.02 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
142 143 5.319043 ACAAGGTTTACATGAAGAGGGAA 57.681 39.130 0.00 0.0 0.00 3.97
196 197 3.623960 TGGGCTGTTATTACACGTTATGC 59.376 43.478 0.00 0.0 0.00 3.14
587 589 2.274437 GAGCACAATTCGCATCTGAGA 58.726 47.619 0.00 0.0 0.00 3.27
740 744 4.947147 GGTCCCACAAGCCACGCA 62.947 66.667 0.00 0.0 0.00 5.24
775 779 0.245539 CACCTGCAATGGCTCTTTGG 59.754 55.000 0.00 0.0 41.91 3.28
778 782 1.530013 GCACACCTGCAATGGCTCTT 61.530 55.000 0.00 0.0 43.62 2.85
1190 1260 1.134401 TGCTCAAAGATCCCGACCATC 60.134 52.381 0.00 0.0 0.00 3.51
1263 1333 0.251354 GAGTCTTGGCCAGAGCATCA 59.749 55.000 5.11 0.0 42.56 3.07
1624 1694 7.007456 GTCACTTCTTCTCTTTTTGTTTCAACG 59.993 37.037 0.00 0.0 0.00 4.10
1794 1865 0.108662 GCAGTTGGCCCATTAGTTGC 60.109 55.000 0.00 0.0 36.11 4.17
1795 1866 1.255882 TGCAGTTGGCCCATTAGTTG 58.744 50.000 0.00 0.0 43.89 3.16
2210 2285 1.927487 TTGTCCTAGCGGTTACCAGA 58.073 50.000 1.13 0.0 0.00 3.86
2229 2304 2.564062 CCCATGTCAAAGTCTTGCCATT 59.436 45.455 0.00 0.0 28.75 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.