Multiple sequence alignment - TraesCS5D01G213400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G213400 chr5D 100.000 2940 0 0 1 2940 322576220 322579159 0.000000e+00 5430
1 TraesCS5D01G213400 chr5A 94.904 2904 75 37 1 2866 419206302 419209170 0.000000e+00 4475
2 TraesCS5D01G213400 chr5B 97.721 2326 33 6 623 2940 374190765 374193078 0.000000e+00 3984
3 TraesCS5D01G213400 chr5B 95.323 620 11 5 9 625 374190058 374190662 0.000000e+00 968
4 TraesCS5D01G213400 chr2D 88.021 192 23 0 1288 1479 9079974 9080165 8.200000e-56 228
5 TraesCS5D01G213400 chr2A 88.021 192 23 0 1288 1479 8543541 8543732 8.200000e-56 228
6 TraesCS5D01G213400 chr2B 87.179 195 25 0 1288 1482 11837389 11837195 3.810000e-54 222
7 TraesCS5D01G213400 chr4B 83.333 150 23 2 1306 1454 30362603 30362751 1.420000e-28 137
8 TraesCS5D01G213400 chr4A 82.667 150 24 2 1306 1454 582840669 582840521 6.610000e-27 132
9 TraesCS5D01G213400 chr4D 82.550 149 24 2 1306 1453 18464575 18464722 2.380000e-26 130


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G213400 chr5D 322576220 322579159 2939 False 5430 5430 100.000 1 2940 1 chr5D.!!$F1 2939
1 TraesCS5D01G213400 chr5A 419206302 419209170 2868 False 4475 4475 94.904 1 2866 1 chr5A.!!$F1 2865
2 TraesCS5D01G213400 chr5B 374190058 374193078 3020 False 2476 3984 96.522 9 2940 2 chr5B.!!$F1 2931

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
338 339 1.289109 ACTACGCACACCAACATCGC 61.289 55.000 0.0 0.0 0.00 4.58 F
510 514 1.748122 CTCAAATGCCCTCGCTGCT 60.748 57.895 0.0 0.0 35.36 4.24 F
1487 1608 1.081376 CCATCGACCGCCTATCGTC 60.081 63.158 0.0 0.0 40.50 4.20 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1317 1438 1.811266 CGTCCGGATCTTGCTGTGG 60.811 63.158 7.81 0.0 0.00 4.17 R
1800 1921 2.276201 TGCATACCGTCCAAGAAATCG 58.724 47.619 0.00 0.0 0.00 3.34 R
2363 2502 2.859165 TTGCGAGGAAGACCATCTTT 57.141 45.000 0.00 0.0 36.73 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 2.940994 TGGCCTTAGTGCAAGTAACA 57.059 45.000 3.32 0.0 31.77 2.41
109 110 3.293311 CACAATTGTGCAGCTAGCTTT 57.707 42.857 24.69 2.4 45.94 3.51
175 176 8.978539 ACTATAAAATCATACGTACATGCACTG 58.021 33.333 0.00 0.0 0.00 3.66
176 177 9.191995 CTATAAAATCATACGTACATGCACTGA 57.808 33.333 0.00 0.0 0.00 3.41
260 261 1.743958 CACGTGTCCCTACAGTAGAGG 59.256 57.143 7.58 8.7 35.91 3.69
337 338 1.985334 TACTACGCACACCAACATCG 58.015 50.000 0.00 0.0 0.00 3.84
338 339 1.289109 ACTACGCACACCAACATCGC 61.289 55.000 0.00 0.0 0.00 4.58
510 514 1.748122 CTCAAATGCCCTCGCTGCT 60.748 57.895 0.00 0.0 35.36 4.24
1485 1606 2.430921 GCCATCGACCGCCTATCG 60.431 66.667 0.00 0.0 41.00 2.92
1486 1607 3.039988 CCATCGACCGCCTATCGT 58.960 61.111 0.00 0.0 40.50 3.73
1487 1608 1.081376 CCATCGACCGCCTATCGTC 60.081 63.158 0.00 0.0 40.50 4.20
1557 1678 1.373497 GCTATCATCGGTGGAGCGG 60.373 63.158 7.59 0.0 0.00 5.52
2278 2417 4.682860 GCACTTTCATGATCAAACACAAGG 59.317 41.667 0.00 0.0 0.00 3.61
2362 2501 9.268282 TCTGTACCTTCTTGACCTAGAATAAAT 57.732 33.333 0.00 0.0 33.89 1.40
2930 3079 6.746745 TTTCGTAATTATGACCCTGGTTTC 57.253 37.500 6.89 0.0 0.00 2.78
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 7.839200 ACCAGGCCACATATTCTTACTTAAATT 59.161 33.333 5.01 0.00 0.00 1.82
109 110 8.046107 TGTCATCATAAGTTAATCCATGTGACA 58.954 33.333 16.41 16.41 37.25 3.58
190 191 9.088987 TGTAAATCTATGTGGTCTCTGCATATA 57.911 33.333 0.00 0.00 0.00 0.86
260 261 1.598601 GGTCGATCGAGGACTACAGTC 59.401 57.143 20.09 2.04 44.04 3.51
268 269 1.026584 TTATTGCGGTCGATCGAGGA 58.973 50.000 24.71 6.23 0.00 3.71
337 338 1.065251 GGTAGGTACGTAGCTGTCTGC 59.935 57.143 31.93 17.73 43.29 4.26
338 339 2.641305 AGGTAGGTACGTAGCTGTCTG 58.359 52.381 31.93 0.00 35.39 3.51
510 514 6.600032 GCTATGCTATAGCTAGGTTACAGAGA 59.400 42.308 24.61 0.70 42.66 3.10
1317 1438 1.811266 CGTCCGGATCTTGCTGTGG 60.811 63.158 7.81 0.00 0.00 4.17
1800 1921 2.276201 TGCATACCGTCCAAGAAATCG 58.724 47.619 0.00 0.00 0.00 3.34
2206 2342 3.824443 GCTCTGTCTATCCTCCTTACCTC 59.176 52.174 0.00 0.00 0.00 3.85
2262 2401 5.066893 CCTGATACCCTTGTGTTTGATCATG 59.933 44.000 0.00 0.00 0.00 3.07
2278 2417 3.188159 TGCATACGGTTTCCTGATACC 57.812 47.619 0.00 0.00 0.00 2.73
2362 2501 3.973206 TTGCGAGGAAGACCATCTTTA 57.027 42.857 0.00 0.00 36.73 1.85
2363 2502 2.859165 TTGCGAGGAAGACCATCTTT 57.141 45.000 0.00 0.00 36.73 2.52
2364 2503 2.859165 TTTGCGAGGAAGACCATCTT 57.141 45.000 0.00 0.00 39.87 2.40
2365 2504 4.487714 TTATTTGCGAGGAAGACCATCT 57.512 40.909 0.00 0.00 38.94 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.