Multiple sequence alignment - TraesCS5D01G197900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G197900 chr5D 100.000 2243 0 0 1 2243 301054398 301056640 0 4143
1 TraesCS5D01G197900 chr4D 97.598 2248 49 5 1 2243 123350119 123352366 0 3847
2 TraesCS5D01G197900 chr4D 96.800 2250 65 5 1 2243 134979421 134981670 0 3749
3 TraesCS5D01G197900 chr4D 95.904 2246 83 6 1 2243 240994777 240992538 0 3629
4 TraesCS5D01G197900 chr4D 97.748 1643 33 4 605 2243 123561662 123563304 0 2826
5 TraesCS5D01G197900 chr6D 96.306 2247 63 11 1 2243 370022515 370024745 0 3672
6 TraesCS5D01G197900 chr6D 96.638 1160 37 2 1085 2243 369972796 369971638 0 1925
7 TraesCS5D01G197900 chr1D 96.215 2246 65 6 1 2243 269426751 269424523 0 3659
8 TraesCS5D01G197900 chr6A 94.353 2249 89 17 1 2243 79195947 79198163 0 3415
9 TraesCS5D01G197900 chr7B 98.018 1312 24 2 1 1310 742948740 742947429 0 2278
10 TraesCS5D01G197900 chr7A 98.018 1312 24 2 1 1310 60168769 60167458 0 2278
11 TraesCS5D01G197900 chr7A 98.014 1309 24 2 1 1307 60084934 60086242 0 2272
12 TraesCS5D01G197900 chr7D 97.946 1217 24 1 1028 2243 382029169 382027953 0 2108


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G197900 chr5D 301054398 301056640 2242 False 4143 4143 100.000 1 2243 1 chr5D.!!$F1 2242
1 TraesCS5D01G197900 chr4D 123350119 123352366 2247 False 3847 3847 97.598 1 2243 1 chr4D.!!$F1 2242
2 TraesCS5D01G197900 chr4D 134979421 134981670 2249 False 3749 3749 96.800 1 2243 1 chr4D.!!$F3 2242
3 TraesCS5D01G197900 chr4D 240992538 240994777 2239 True 3629 3629 95.904 1 2243 1 chr4D.!!$R1 2242
4 TraesCS5D01G197900 chr4D 123561662 123563304 1642 False 2826 2826 97.748 605 2243 1 chr4D.!!$F2 1638
5 TraesCS5D01G197900 chr6D 370022515 370024745 2230 False 3672 3672 96.306 1 2243 1 chr6D.!!$F1 2242
6 TraesCS5D01G197900 chr6D 369971638 369972796 1158 True 1925 1925 96.638 1085 2243 1 chr6D.!!$R1 1158
7 TraesCS5D01G197900 chr1D 269424523 269426751 2228 True 3659 3659 96.215 1 2243 1 chr1D.!!$R1 2242
8 TraesCS5D01G197900 chr6A 79195947 79198163 2216 False 3415 3415 94.353 1 2243 1 chr6A.!!$F1 2242
9 TraesCS5D01G197900 chr7B 742947429 742948740 1311 True 2278 2278 98.018 1 1310 1 chr7B.!!$R1 1309
10 TraesCS5D01G197900 chr7A 60167458 60168769 1311 True 2278 2278 98.018 1 1310 1 chr7A.!!$R1 1309
11 TraesCS5D01G197900 chr7A 60084934 60086242 1308 False 2272 2272 98.014 1 1307 1 chr7A.!!$F1 1306
12 TraesCS5D01G197900 chr7D 382027953 382029169 1216 True 2108 2108 97.946 1028 2243 1 chr7D.!!$R1 1215

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
312 313 1.688197 CAGAAGTGCCCAAACAACCAT 59.312 47.619 0.0 0.0 0.0 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2215 2233 2.133195 AGTCCTGCGACTCCAAACA 58.867 52.632 0.0 0.0 46.9 2.83 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 3.402628 AACACAAGCTGGAGACGTATT 57.597 42.857 0.00 0.00 0.00 1.89
179 180 6.543831 AGTTGAAAGCTATGAAACAAGTCTGT 59.456 34.615 0.00 0.00 37.39 3.41
253 254 3.814504 ATTTGGGTCAGACCTTGATGT 57.185 42.857 19.57 0.00 38.64 3.06
312 313 1.688197 CAGAAGTGCCCAAACAACCAT 59.312 47.619 0.00 0.00 0.00 3.55
333 334 8.608185 ACCATAATATGAACCACTTCCAATTT 57.392 30.769 1.10 0.00 0.00 1.82
959 965 7.122650 TCAACAAGAAATCCAAGAAAGAACAGT 59.877 33.333 0.00 0.00 0.00 3.55
1055 1064 2.677836 CTGCTACAATTGCTTTAGCCGA 59.322 45.455 18.65 5.64 37.95 5.54
1072 1081 2.203800 CGAAGCTGCTGTCGGTATTA 57.796 50.000 19.44 0.00 33.62 0.98
1207 1216 0.462789 CCCAATGATGGCCTTTCTGC 59.537 55.000 3.32 0.00 46.09 4.26
1317 1327 2.752903 TCGTTCTCTTGGTCGATGATGA 59.247 45.455 0.00 0.00 0.00 2.92
1401 1411 4.212716 GGAGTAACCACTTTTGAAAGGGT 58.787 43.478 8.23 8.93 37.74 4.34
1530 1548 8.778358 GGGACTTTCATAGTTATCATTGTGATC 58.222 37.037 0.00 0.00 36.38 2.92
1650 1668 1.069227 GGTGCCACGTTGATTGAAGAC 60.069 52.381 0.00 0.00 0.00 3.01
1697 1715 2.283101 ATGTGCAACCGTGGGCAT 60.283 55.556 0.00 0.00 42.75 4.40
1803 1821 1.375523 CCTTAACGAACAGCCGCCT 60.376 57.895 0.00 0.00 0.00 5.52
1988 2006 1.264749 TATCCAGCTCCGCCAACAGT 61.265 55.000 0.00 0.00 0.00 3.55
2019 2037 2.479730 CGACAGTAATGCTAAGGACGCT 60.480 50.000 0.00 0.00 0.00 5.07
2215 2233 9.807921 TGGAGGATTTGATAGAACTAAAACTTT 57.192 29.630 0.00 0.00 0.00 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 1.710244 CATTGGTGGGGATATAGGCCA 59.290 52.381 5.01 0.00 0.00 5.36
179 180 4.038642 GCCAATTCCAGTTTTGAACTACCA 59.961 41.667 0.00 0.00 40.46 3.25
253 254 4.350368 TTGAGTAATGCCTGAGTCACAA 57.650 40.909 0.00 0.00 0.00 3.33
556 558 2.032620 CCTACATCTGCGAGTAAGGGT 58.967 52.381 0.00 0.00 0.00 4.34
959 965 5.182380 ACTTTCTTGTCACGTTTTTCCTTCA 59.818 36.000 0.00 0.00 0.00 3.02
1055 1064 3.887621 TTCTAATACCGACAGCAGCTT 57.112 42.857 0.00 0.00 0.00 3.74
1072 1081 4.402056 TCAAAGAACTGAGGACGTTTCT 57.598 40.909 0.00 0.00 0.00 2.52
1317 1327 7.027161 CCAATCGTCAAAATCGATAAAAAGGT 58.973 34.615 0.00 0.00 45.33 3.50
1327 1337 5.046529 AGAGAGATCCAATCGTCAAAATCG 58.953 41.667 0.00 0.00 0.00 3.34
1507 1525 7.712639 AGCGATCACAATGATAACTATGAAAGT 59.287 33.333 0.00 0.00 37.20 2.66
1508 1526 8.008279 CAGCGATCACAATGATAACTATGAAAG 58.992 37.037 0.00 0.00 37.20 2.62
1530 1548 3.570550 AGGGATCTACTACTAAAGCAGCG 59.429 47.826 0.00 0.00 0.00 5.18
1650 1668 2.505982 CAGAGGGCCGGTACCATG 59.494 66.667 13.54 12.35 0.00 3.66
1954 1972 6.039829 GGAGCTGGATATTTTTCTCGGATTTT 59.960 38.462 0.00 0.00 0.00 1.82
1988 2006 2.737359 GCATTACTGTCGGGATCGTCAA 60.737 50.000 0.00 0.00 34.45 3.18
2019 2037 3.737559 AATTGGAGCATACCCAGAACA 57.262 42.857 0.00 0.00 34.77 3.18
2171 2189 9.425248 AATCCTCCAAGCAATTGATATTCTTTA 57.575 29.630 10.34 0.00 0.00 1.85
2215 2233 2.133195 AGTCCTGCGACTCCAAACA 58.867 52.632 0.00 0.00 46.90 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.