Multiple sequence alignment - TraesCS5D01G192500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G192500 chr5D 100.000 2524 0 0 1 2524 296180879 296178356 0.000000e+00 4662.0
1 TraesCS5D01G192500 chr5D 97.615 1845 27 6 640 2482 80200631 80202460 0.000000e+00 3147.0
2 TraesCS5D01G192500 chr5D 95.296 1892 57 10 640 2524 378328797 378330663 0.000000e+00 2972.0
3 TraesCS5D01G192500 chr5D 97.468 1659 22 2 886 2524 559442045 559440387 0.000000e+00 2813.0
4 TraesCS5D01G192500 chr5D 94.540 641 32 3 1 639 312859163 312859802 0.000000e+00 987.0
5 TraesCS5D01G192500 chr5D 96.486 313 8 1 640 952 296176777 296177086 4.810000e-142 514.0
6 TraesCS5D01G192500 chr5D 93.312 314 14 3 639 952 559438826 559439132 8.230000e-125 457.0
7 TraesCS5D01G192500 chr5D 91.447 304 19 4 640 941 525304407 525304705 6.500000e-111 411.0
8 TraesCS5D01G192500 chr5D 100.000 44 0 0 2481 2524 80202652 80202695 5.790000e-12 82.4
9 TraesCS5D01G192500 chr1B 87.234 1222 100 24 1005 2191 583684599 583685799 0.000000e+00 1341.0
10 TraesCS5D01G192500 chr1B 97.024 168 5 0 2357 2524 583686387 583686554 1.480000e-72 283.0
11 TraesCS5D01G192500 chr1B 94.857 175 8 1 2175 2348 583685838 583686012 3.200000e-69 272.0
12 TraesCS5D01G192500 chr3D 94.210 639 36 1 1 639 396200648 396201285 0.000000e+00 974.0
13 TraesCS5D01G192500 chr3D 93.769 642 37 3 1 639 250307334 250307975 0.000000e+00 961.0
14 TraesCS5D01G192500 chr3D 93.614 642 38 2 1 639 467716668 467717309 0.000000e+00 955.0
15 TraesCS5D01G192500 chr3D 93.798 258 13 1 640 897 231895403 231895149 3.940000e-103 385.0
16 TraesCS5D01G192500 chr7A 94.053 639 36 1 1 639 530774792 530775428 0.000000e+00 968.0
17 TraesCS5D01G192500 chr7D 93.769 642 35 4 1 639 123574877 123575516 0.000000e+00 959.0
18 TraesCS5D01G192500 chr7D 93.750 640 39 1 1 639 139971884 139971245 0.000000e+00 959.0
19 TraesCS5D01G192500 chr7D 93.614 642 38 3 1 639 153969770 153969129 0.000000e+00 955.0
20 TraesCS5D01G192500 chr7D 94.515 237 7 3 640 876 634159435 634159205 6.640000e-96 361.0
21 TraesCS5D01G192500 chr7D 83.060 183 28 3 628 809 78262391 78262211 2.010000e-36 163.0
22 TraesCS5D01G192500 chr7D 81.061 132 24 1 2081 2211 33274896 33275027 1.240000e-18 104.0
23 TraesCS5D01G192500 chr7D 81.061 132 24 1 2081 2211 33294613 33294744 1.240000e-18 104.0
24 TraesCS5D01G192500 chr7D 78.767 146 30 1 2066 2210 607618382 607618237 2.070000e-16 97.1
25 TraesCS5D01G192500 chr7D 78.231 147 30 2 2066 2210 610212221 610212367 2.670000e-15 93.5
26 TraesCS5D01G192500 chr4D 93.584 639 39 2 1 639 65400562 65399926 0.000000e+00 952.0
27 TraesCS5D01G192500 chr4D 90.800 250 15 5 639 887 475746990 475746748 6.730000e-86 327.0
28 TraesCS5D01G192500 chr1D 87.838 814 53 25 1005 1803 432201723 432202505 0.000000e+00 913.0
29 TraesCS5D01G192500 chr1D 93.798 258 8 2 640 897 27849341 27849590 5.090000e-102 381.0
30 TraesCS5D01G192500 chr1D 97.619 168 4 0 2357 2524 432203456 432203623 3.180000e-74 289.0
31 TraesCS5D01G192500 chr1D 90.351 114 7 4 1788 1899 432202840 432202951 2.020000e-31 147.0
32 TraesCS5D01G192500 chr1D 84.127 126 12 3 2226 2351 432202972 432203089 5.710000e-22 115.0
33 TraesCS5D01G192500 chr1A 88.933 759 38 16 1005 1726 530726258 530727007 0.000000e+00 894.0
34 TraesCS5D01G192500 chr1A 89.650 628 47 12 1737 2352 530728192 530728813 0.000000e+00 784.0
35 TraesCS5D01G192500 chr1A 96.429 168 6 0 2357 2524 530729168 530729335 6.880000e-71 278.0
36 TraesCS5D01G192500 chr2A 79.428 734 86 42 1043 1735 717819389 717818680 2.290000e-125 459.0
37 TraesCS5D01G192500 chr2A 81.690 142 24 2 2081 2220 53333175 53333316 1.590000e-22 117.0
38 TraesCS5D01G192500 chr6D 96.635 208 5 2 639 845 216837553 216837347 6.680000e-91 344.0
39 TraesCS5D01G192500 chr2D 94.931 217 6 3 632 847 166313257 166313469 4.020000e-88 335.0
40 TraesCS5D01G192500 chr2D 76.133 750 100 51 1043 1758 579963476 579962772 1.130000e-83 320.0
41 TraesCS5D01G192500 chr6B 84.615 195 25 4 639 831 663757990 663757799 3.310000e-44 189.0
42 TraesCS5D01G192500 chr7B 90.323 124 11 1 632 755 554160469 554160591 7.230000e-36 161.0
43 TraesCS5D01G192500 chr7B 80.663 181 33 2 630 809 439300787 439300966 3.390000e-29 139.0
44 TraesCS5D01G192500 chr3B 83.815 173 25 3 631 802 534730107 534730277 7.230000e-36 161.0
45 TraesCS5D01G192500 chr6A 81.690 142 24 2 2081 2220 531385479 531385338 1.590000e-22 117.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G192500 chr5D 296178356 296180879 2523 True 4662.0 4662 100.000000 1 2524 1 chr5D.!!$R1 2523
1 TraesCS5D01G192500 chr5D 378328797 378330663 1866 False 2972.0 2972 95.296000 640 2524 1 chr5D.!!$F3 1884
2 TraesCS5D01G192500 chr5D 559440387 559442045 1658 True 2813.0 2813 97.468000 886 2524 1 chr5D.!!$R2 1638
3 TraesCS5D01G192500 chr5D 80200631 80202695 2064 False 1614.7 3147 98.807500 640 2524 2 chr5D.!!$F6 1884
4 TraesCS5D01G192500 chr5D 312859163 312859802 639 False 987.0 987 94.540000 1 639 1 chr5D.!!$F2 638
5 TraesCS5D01G192500 chr1B 583684599 583686554 1955 False 632.0 1341 93.038333 1005 2524 3 chr1B.!!$F1 1519
6 TraesCS5D01G192500 chr3D 396200648 396201285 637 False 974.0 974 94.210000 1 639 1 chr3D.!!$F2 638
7 TraesCS5D01G192500 chr3D 250307334 250307975 641 False 961.0 961 93.769000 1 639 1 chr3D.!!$F1 638
8 TraesCS5D01G192500 chr3D 467716668 467717309 641 False 955.0 955 93.614000 1 639 1 chr3D.!!$F3 638
9 TraesCS5D01G192500 chr7A 530774792 530775428 636 False 968.0 968 94.053000 1 639 1 chr7A.!!$F1 638
10 TraesCS5D01G192500 chr7D 123574877 123575516 639 False 959.0 959 93.769000 1 639 1 chr7D.!!$F3 638
11 TraesCS5D01G192500 chr7D 139971245 139971884 639 True 959.0 959 93.750000 1 639 1 chr7D.!!$R2 638
12 TraesCS5D01G192500 chr7D 153969129 153969770 641 True 955.0 955 93.614000 1 639 1 chr7D.!!$R3 638
13 TraesCS5D01G192500 chr4D 65399926 65400562 636 True 952.0 952 93.584000 1 639 1 chr4D.!!$R1 638
14 TraesCS5D01G192500 chr1D 432201723 432203623 1900 False 366.0 913 89.983750 1005 2524 4 chr1D.!!$F2 1519
15 TraesCS5D01G192500 chr1A 530726258 530729335 3077 False 652.0 894 91.670667 1005 2524 3 chr1A.!!$F1 1519
16 TraesCS5D01G192500 chr2A 717818680 717819389 709 True 459.0 459 79.428000 1043 1735 1 chr2A.!!$R1 692
17 TraesCS5D01G192500 chr2D 579962772 579963476 704 True 320.0 320 76.133000 1043 1758 1 chr2D.!!$R1 715

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
358 369 0.264955 TGACCCCCTGACCTAGATCC 59.735 60.0 0.0 0.0 0.0 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2125 3841 0.039618 GGAAAGCTGGGGGTTCATCA 59.96 55.0 0.0 0.0 32.26 3.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 129 5.601729 ACTAACCTATTAACCTAGAGCCCAC 59.398 44.000 0.00 0.0 0.00 4.61
173 179 6.262273 TGTTTTAGAGTTTCGCAGAAAAGGAT 59.738 34.615 5.51 0.0 45.90 3.24
217 223 8.964420 TGGAATAAAACTTTCACGATGATTTC 57.036 30.769 0.00 0.0 0.00 2.17
358 369 0.264955 TGACCCCCTGACCTAGATCC 59.735 60.000 0.00 0.0 0.00 3.36
541 553 1.153549 GCCTCTCCGATGAAGCGTT 60.154 57.895 0.00 0.0 0.00 4.84
555 567 4.229096 TGAAGCGTTAGTAGTTTACCACG 58.771 43.478 4.90 4.9 38.32 4.94
561 573 4.321230 CGTTAGTAGTTTACCACGGACCTT 60.321 45.833 0.00 0.0 34.17 3.50
580 592 3.498121 CCTTCGGGTCCATAGCTAGTAGA 60.498 52.174 0.00 0.0 0.00 2.59
668 680 3.814625 TGCACAGAAGTACCACAATTGA 58.185 40.909 13.59 0.0 0.00 2.57
687 699 2.291089 TGAGGCATTGGAAGCAGATTGA 60.291 45.455 0.00 0.0 0.00 2.57
769 781 5.653507 AGGTCTAAATCGCGTATAAACACA 58.346 37.500 5.77 0.0 0.00 3.72
1309 1410 4.389890 TTCAATCTGCTGTTGCTTTTGT 57.610 36.364 0.00 0.0 40.48 2.83
1325 1426 2.202932 GTGGCAGATCACGGCGAT 60.203 61.111 16.62 0.0 38.05 4.58
1360 1467 3.069318 GGAGGAGGCGGAGAACGT 61.069 66.667 0.00 0.0 46.52 3.99
1400 1507 0.389025 TCGACATGGACATGCGCTAT 59.611 50.000 9.73 0.0 42.39 2.97
1827 3532 9.258629 TGACCCTGATTGAAAATTAGAATGAAT 57.741 29.630 0.00 0.0 0.00 2.57
1947 3655 8.514594 GGATTCGATTCAAATTATCAATGCCTA 58.485 33.333 9.36 0.0 0.00 3.93
2125 3841 6.377146 ACGATAATGCTTCTTGTAATTGGGTT 59.623 34.615 0.00 0.0 0.00 4.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 101 5.837438 GGCTCTAGGTTAATAGGTTAGTCCA 59.163 44.000 0.00 0.00 39.02 4.02
147 153 6.262273 TCCTTTTCTGCGAAACTCTAAAACAT 59.738 34.615 3.71 0.00 0.00 2.71
173 179 3.150767 CCATTTGGACTCCGTTTGGTAA 58.849 45.455 0.00 0.00 37.39 2.85
217 223 1.002544 GGGTGTCTTCTGGTCCAAGAG 59.997 57.143 0.00 0.00 30.32 2.85
358 369 8.929487 GGGGTATTTGAGAATATATAGGAGGAG 58.071 40.741 0.00 0.00 30.84 3.69
392 403 4.344865 TTTCGTGGCTCCCCTGGC 62.345 66.667 0.00 0.00 0.00 4.85
475 486 3.560251 CGAATCCCCCTCCGGCAT 61.560 66.667 0.00 0.00 0.00 4.40
541 553 3.440173 CGAAGGTCCGTGGTAAACTACTA 59.560 47.826 0.00 0.00 0.00 1.82
561 573 4.781621 TCTATCTACTAGCTATGGACCCGA 59.218 45.833 0.00 0.00 0.00 5.14
580 592 6.610830 TCAAAGAGAGAGAAGAAGCCATCTAT 59.389 38.462 0.00 0.00 37.42 1.98
668 680 2.519771 TCAATCTGCTTCCAATGCCT 57.480 45.000 0.00 0.00 0.00 4.75
769 781 5.129320 TGCCAGTCAGATACACTGTCAATAT 59.871 40.000 0.00 0.00 45.86 1.28
981 1043 3.642778 TTCTCTTTCTCGCCGGCGG 62.643 63.158 44.95 34.43 40.25 6.13
982 1044 1.084370 ATTTCTCTTTCTCGCCGGCG 61.084 55.000 42.13 42.13 41.35 6.46
983 1045 0.375106 CATTTCTCTTTCTCGCCGGC 59.625 55.000 19.07 19.07 0.00 6.13
984 1046 2.010145 TCATTTCTCTTTCTCGCCGG 57.990 50.000 0.00 0.00 0.00 6.13
985 1047 4.606457 ATTTCATTTCTCTTTCTCGCCG 57.394 40.909 0.00 0.00 0.00 6.46
986 1048 6.422776 TGTATTTCATTTCTCTTTCTCGCC 57.577 37.500 0.00 0.00 0.00 5.54
987 1049 7.298122 TGTTGTATTTCATTTCTCTTTCTCGC 58.702 34.615 0.00 0.00 0.00 5.03
988 1050 8.712363 TCTGTTGTATTTCATTTCTCTTTCTCG 58.288 33.333 0.00 0.00 0.00 4.04
990 1052 9.784531 TCTCTGTTGTATTTCATTTCTCTTTCT 57.215 29.630 0.00 0.00 0.00 2.52
992 1054 9.784531 TCTCTCTGTTGTATTTCATTTCTCTTT 57.215 29.630 0.00 0.00 0.00 2.52
993 1055 9.956640 ATCTCTCTGTTGTATTTCATTTCTCTT 57.043 29.630 0.00 0.00 0.00 2.85
1309 1410 2.202919 CATCGCCGTGATCTGCCA 60.203 61.111 0.00 0.00 34.13 4.92
1360 1467 2.285668 CCCTGGCCTTCCTCTCCA 60.286 66.667 3.32 0.00 0.00 3.86
1648 1812 3.321648 ACGCACCCAGCAGGATCA 61.322 61.111 0.00 0.00 46.13 2.92
1827 3532 4.729227 TCAAGTGCGGTCATATAGAACA 57.271 40.909 0.00 0.00 31.63 3.18
1947 3655 8.386264 CCCCAAATTCTATATCTTGTCCTGTAT 58.614 37.037 0.00 0.00 0.00 2.29
1949 3657 6.160459 ACCCCAAATTCTATATCTTGTCCTGT 59.840 38.462 0.00 0.00 0.00 4.00
2125 3841 0.039618 GGAAAGCTGGGGGTTCATCA 59.960 55.000 0.00 0.00 32.26 3.07


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.