Multiple sequence alignment - TraesCS5D01G152600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G152600 chr5D 100.000 2829 0 0 320 3148 241419686 241416858 0.000 5225.0
1 TraesCS5D01G152600 chr5D 100.000 29 0 0 1 29 241420005 241419977 0.002 54.7
2 TraesCS5D01G152600 chr1D 97.224 1765 48 1 357 2121 451783460 451785223 0.000 2987.0
3 TraesCS5D01G152600 chr1D 96.113 1029 38 2 2121 3148 480488520 480487493 0.000 1677.0
4 TraesCS5D01G152600 chr1D 91.755 1043 68 12 2121 3148 436305746 436306785 0.000 1434.0
5 TraesCS5D01G152600 chr1D 91.659 1043 71 7 2118 3145 414511527 414512568 0.000 1430.0
6 TraesCS5D01G152600 chr1D 100.000 29 0 0 1 29 363528319 363528291 0.002 54.7
7 TraesCS5D01G152600 chr3D 97.452 1727 32 3 407 2121 557718344 557716618 0.000 2935.0
8 TraesCS5D01G152600 chr3D 97.237 1737 37 3 394 2121 58419696 58421430 0.000 2931.0
9 TraesCS5D01G152600 chr3D 96.919 1720 45 6 407 2121 582511325 582513041 0.000 2876.0
10 TraesCS5D01G152600 chr3D 91.764 1032 73 11 2120 3148 367863186 367862164 0.000 1424.0
11 TraesCS5D01G152600 chr7D 97.437 1717 41 3 407 2121 24347200 24348915 0.000 2924.0
12 TraesCS5D01G152600 chr7D 96.439 1769 49 5 365 2121 468270698 468272464 0.000 2905.0
13 TraesCS5D01G152600 chr7D 96.558 1627 46 4 502 2121 115055650 115057273 0.000 2686.0
14 TraesCS5D01G152600 chr7D 97.090 1031 28 2 2119 3148 396365205 396364176 0.000 1736.0
15 TraesCS5D01G152600 chr7D 96.210 1029 36 3 2120 3148 120730113 120729088 0.000 1681.0
16 TraesCS5D01G152600 chr7D 95.914 1028 37 4 2121 3148 120736666 120735644 0.000 1661.0
17 TraesCS5D01G152600 chr7D 92.123 1041 66 11 2121 3148 528237388 528236351 0.000 1454.0
18 TraesCS5D01G152600 chr7D 91.843 1042 66 14 2121 3148 82222538 82223574 0.000 1435.0
19 TraesCS5D01G152600 chr4D 96.512 1749 52 7 375 2121 461817494 461819235 0.000 2883.0
20 TraesCS5D01G152600 chr2D 96.842 1615 37 8 518 2121 422069279 422070890 0.000 2687.0
21 TraesCS5D01G152600 chr4B 91.765 1275 88 16 382 1648 66180497 66181762 0.000 1757.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G152600 chr5D 241416858 241420005 3147 True 2639.85 5225 100.000 1 3148 2 chr5D.!!$R1 3147
1 TraesCS5D01G152600 chr1D 451783460 451785223 1763 False 2987.00 2987 97.224 357 2121 1 chr1D.!!$F3 1764
2 TraesCS5D01G152600 chr1D 480487493 480488520 1027 True 1677.00 1677 96.113 2121 3148 1 chr1D.!!$R2 1027
3 TraesCS5D01G152600 chr1D 436305746 436306785 1039 False 1434.00 1434 91.755 2121 3148 1 chr1D.!!$F2 1027
4 TraesCS5D01G152600 chr1D 414511527 414512568 1041 False 1430.00 1430 91.659 2118 3145 1 chr1D.!!$F1 1027
5 TraesCS5D01G152600 chr3D 557716618 557718344 1726 True 2935.00 2935 97.452 407 2121 1 chr3D.!!$R2 1714
6 TraesCS5D01G152600 chr3D 58419696 58421430 1734 False 2931.00 2931 97.237 394 2121 1 chr3D.!!$F1 1727
7 TraesCS5D01G152600 chr3D 582511325 582513041 1716 False 2876.00 2876 96.919 407 2121 1 chr3D.!!$F2 1714
8 TraesCS5D01G152600 chr3D 367862164 367863186 1022 True 1424.00 1424 91.764 2120 3148 1 chr3D.!!$R1 1028
9 TraesCS5D01G152600 chr7D 24347200 24348915 1715 False 2924.00 2924 97.437 407 2121 1 chr7D.!!$F1 1714
10 TraesCS5D01G152600 chr7D 468270698 468272464 1766 False 2905.00 2905 96.439 365 2121 1 chr7D.!!$F4 1756
11 TraesCS5D01G152600 chr7D 115055650 115057273 1623 False 2686.00 2686 96.558 502 2121 1 chr7D.!!$F3 1619
12 TraesCS5D01G152600 chr7D 396364176 396365205 1029 True 1736.00 1736 97.090 2119 3148 1 chr7D.!!$R3 1029
13 TraesCS5D01G152600 chr7D 120729088 120730113 1025 True 1681.00 1681 96.210 2120 3148 1 chr7D.!!$R1 1028
14 TraesCS5D01G152600 chr7D 120735644 120736666 1022 True 1661.00 1661 95.914 2121 3148 1 chr7D.!!$R2 1027
15 TraesCS5D01G152600 chr7D 528236351 528237388 1037 True 1454.00 1454 92.123 2121 3148 1 chr7D.!!$R4 1027
16 TraesCS5D01G152600 chr7D 82222538 82223574 1036 False 1435.00 1435 91.843 2121 3148 1 chr7D.!!$F2 1027
17 TraesCS5D01G152600 chr4D 461817494 461819235 1741 False 2883.00 2883 96.512 375 2121 1 chr4D.!!$F1 1746
18 TraesCS5D01G152600 chr2D 422069279 422070890 1611 False 2687.00 2687 96.842 518 2121 1 chr2D.!!$F1 1603
19 TraesCS5D01G152600 chr4B 66180497 66181762 1265 False 1757.00 1757 91.765 382 1648 1 chr4B.!!$F1 1266

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
609 646 1.218316 CGAACTAGGACCAGGCCAC 59.782 63.158 5.01 0.0 0.0 5.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2191 2244 0.108186 TGGTGCCTCATCAGCTAACG 60.108 55.0 0.0 0.0 35.63 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
609 646 1.218316 CGAACTAGGACCAGGCCAC 59.782 63.158 5.01 0.0 0.00 5.01
614 651 1.965754 CTAGGACCAGGCCACAGAGC 61.966 65.000 5.01 0.0 0.00 4.09
645 688 5.106436 GCGCGGTTATTTATATTTTAGCCCT 60.106 40.000 8.83 0.0 0.00 5.19
648 691 6.148315 GCGGTTATTTATATTTTAGCCCTCGT 59.852 38.462 0.00 0.0 0.00 4.18
810 855 5.300752 ACTAGATGCGCTTAACATGCTATT 58.699 37.500 9.73 0.0 0.00 1.73
1030 1075 5.747842 GGAATTGTCCACAAGGAGTTTCCTA 60.748 44.000 11.89 0.0 44.67 2.94
1411 1457 3.225104 ACTCTTCGGTTGTGTGGTACTA 58.775 45.455 0.00 0.0 0.00 1.82
1756 1809 1.152963 ACTGCTTCCGTTGTGGCTT 60.153 52.632 0.00 0.0 37.80 4.35
1932 1985 2.445845 CCATAGAGGCGACCCCCA 60.446 66.667 0.00 0.0 0.00 4.96
2047 2100 1.404391 CATTGATGCTGCCTCCAAGAC 59.596 52.381 0.00 0.0 0.00 3.01
2050 2103 1.078848 ATGCTGCCTCCAAGACGAC 60.079 57.895 0.00 0.0 0.00 4.34
2148 2201 3.756933 CCGGGTTTTCGGGATATTAGA 57.243 47.619 0.00 0.0 45.78 2.10
2191 2244 1.227383 CACCAGCCCCAGGATTACC 59.773 63.158 0.00 0.0 0.00 2.85
2595 2661 8.826710 GTCTGTCACGAAATATATGAAATCCAA 58.173 33.333 0.00 0.0 0.00 3.53
3088 3171 7.398024 AGGGCTTATAATAGAATAGTTGCAGG 58.602 38.462 0.00 0.0 0.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
645 688 5.681105 GTCGCATAAATTTACGGTACTACGA 59.319 40.000 0.00 0.00 37.61 3.43
996 1041 0.394352 GGACAATTCCGGCCATCTGT 60.394 55.000 2.24 0.00 29.98 3.41
1271 1317 1.070134 TGTACTTCAGCCGCTCAAACT 59.930 47.619 0.00 0.00 0.00 2.66
1411 1457 3.709587 TCTTCTGGGAGTCGGTAATCTT 58.290 45.455 0.00 0.00 0.00 2.40
1618 1664 0.603975 GGCTTGCGGACTTTGAGAGT 60.604 55.000 0.00 0.00 42.70 3.24
2047 2100 1.001158 GCCGATCCTCCTTAGAAGTCG 60.001 57.143 0.00 0.00 0.00 4.18
2050 2103 2.035321 GTGAGCCGATCCTCCTTAGAAG 59.965 54.545 0.00 0.00 0.00 2.85
2191 2244 0.108186 TGGTGCCTCATCAGCTAACG 60.108 55.000 0.00 0.00 35.63 3.18
2595 2661 0.462375 TTACCCGCATGCGTACATCT 59.538 50.000 35.55 14.86 37.81 2.90
2641 2718 5.644977 TCAGACACTCGATCACTACATTT 57.355 39.130 0.00 0.00 0.00 2.32
3088 3171 2.327373 GTTCTACCTCCTGGATACCCC 58.673 57.143 0.00 0.00 37.04 4.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.