Multiple sequence alignment - TraesCS5D01G151500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G151500 chr5D 100.000 2273 0 0 1 2273 240523347 240521075 0 4198
1 TraesCS5D01G151500 chr5D 97.436 975 19 3 1301 2273 240534350 240533380 0 1657
2 TraesCS5D01G151500 chr3D 98.537 1299 19 0 1 1299 406417577 406418875 0 2294
3 TraesCS5D01G151500 chr3D 97.771 1301 28 1 1 1301 570309816 570311115 0 2241
4 TraesCS5D01G151500 chr3D 95.184 976 40 5 1301 2273 103735855 103736826 0 1535
5 TraesCS5D01G151500 chr3D 95.184 976 40 4 1301 2273 594556989 594557960 0 1535
6 TraesCS5D01G151500 chr3D 94.985 977 42 5 1301 2273 309906454 309907427 0 1526
7 TraesCS5D01G151500 chr2D 98.002 1301 26 0 1 1301 650478411 650477111 0 2259
8 TraesCS5D01G151500 chr1D 97.925 1301 25 1 1 1301 431515449 431516747 0 2252
9 TraesCS5D01G151500 chr1D 95.297 978 36 8 1301 2273 462257734 462256762 0 1543
10 TraesCS5D01G151500 chr7D 97.463 1301 33 0 1 1301 554425499 554426799 0 2220
11 TraesCS5D01G151500 chr7D 94.888 978 42 5 1301 2273 117191620 117190646 0 1522
12 TraesCS5D01G151500 chr7D 94.893 979 36 8 1303 2273 51484501 51485473 0 1519
13 TraesCS5D01G151500 chr5A 93.467 1301 85 0 1 1301 415261548 415260248 0 1932
14 TraesCS5D01G151500 chr6D 95.492 976 37 5 1301 2273 450788533 450789504 0 1552
15 TraesCS5D01G151500 chr4D 95.483 974 38 4 1301 2271 19363571 19362601 0 1550
16 TraesCS5D01G151500 chr2B 87.832 1241 147 4 62 1301 109881552 109880315 0 1452
17 TraesCS5D01G151500 chrUn 86.493 1303 172 4 1 1301 336409524 336410824 0 1428
18 TraesCS5D01G151500 chr6B 85.353 1304 179 10 1 1301 67339749 67341043 0 1339


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G151500 chr5D 240521075 240523347 2272 True 4198 4198 100.000 1 2273 1 chr5D.!!$R1 2272
1 TraesCS5D01G151500 chr5D 240533380 240534350 970 True 1657 1657 97.436 1301 2273 1 chr5D.!!$R2 972
2 TraesCS5D01G151500 chr3D 406417577 406418875 1298 False 2294 2294 98.537 1 1299 1 chr3D.!!$F3 1298
3 TraesCS5D01G151500 chr3D 570309816 570311115 1299 False 2241 2241 97.771 1 1301 1 chr3D.!!$F4 1300
4 TraesCS5D01G151500 chr3D 103735855 103736826 971 False 1535 1535 95.184 1301 2273 1 chr3D.!!$F1 972
5 TraesCS5D01G151500 chr3D 594556989 594557960 971 False 1535 1535 95.184 1301 2273 1 chr3D.!!$F5 972
6 TraesCS5D01G151500 chr3D 309906454 309907427 973 False 1526 1526 94.985 1301 2273 1 chr3D.!!$F2 972
7 TraesCS5D01G151500 chr2D 650477111 650478411 1300 True 2259 2259 98.002 1 1301 1 chr2D.!!$R1 1300
8 TraesCS5D01G151500 chr1D 431515449 431516747 1298 False 2252 2252 97.925 1 1301 1 chr1D.!!$F1 1300
9 TraesCS5D01G151500 chr1D 462256762 462257734 972 True 1543 1543 95.297 1301 2273 1 chr1D.!!$R1 972
10 TraesCS5D01G151500 chr7D 554425499 554426799 1300 False 2220 2220 97.463 1 1301 1 chr7D.!!$F2 1300
11 TraesCS5D01G151500 chr7D 117190646 117191620 974 True 1522 1522 94.888 1301 2273 1 chr7D.!!$R1 972
12 TraesCS5D01G151500 chr7D 51484501 51485473 972 False 1519 1519 94.893 1303 2273 1 chr7D.!!$F1 970
13 TraesCS5D01G151500 chr5A 415260248 415261548 1300 True 1932 1932 93.467 1 1301 1 chr5A.!!$R1 1300
14 TraesCS5D01G151500 chr6D 450788533 450789504 971 False 1552 1552 95.492 1301 2273 1 chr6D.!!$F1 972
15 TraesCS5D01G151500 chr4D 19362601 19363571 970 True 1550 1550 95.483 1301 2271 1 chr4D.!!$R1 970
16 TraesCS5D01G151500 chr2B 109880315 109881552 1237 True 1452 1452 87.832 62 1301 1 chr2B.!!$R1 1239
17 TraesCS5D01G151500 chrUn 336409524 336410824 1300 False 1428 1428 86.493 1 1301 1 chrUn.!!$F1 1300
18 TraesCS5D01G151500 chr6B 67339749 67341043 1294 False 1339 1339 85.353 1 1301 1 chr6B.!!$F1 1300

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
22 23 0.865769 GAACACGACCGCACTGAAAT 59.134 50.0 0.0 0.0 0.0 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1607 1610 0.409092 TTGGCTCCCACATGTTCCAT 59.591 50.0 0.0 0.0 30.78 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 0.865769 GAACACGACCGCACTGAAAT 59.134 50.000 0.00 0.0 0.00 2.17
822 825 3.056322 GGGTCACTATAAACACTGACGGT 60.056 47.826 0.00 0.0 34.94 4.83
1064 1067 3.494626 CGCAGTAACACAAGATCAGTTGT 59.505 43.478 0.00 0.0 41.47 3.32
1103 1106 8.773033 AATGAATTAGAGGAAATTGGTGCTAT 57.227 30.769 0.00 0.0 0.00 2.97
1333 1336 4.357918 AAGTATCTGTTGAGTTGGCACT 57.642 40.909 0.00 0.0 35.17 4.40
1338 1341 4.350368 TCTGTTGAGTTGGCACTAATCA 57.650 40.909 0.00 0.0 31.22 2.57
1352 1355 4.439289 GCACTAATCAAGACTGGGATTTGC 60.439 45.833 7.66 8.6 35.49 3.68
1895 1900 3.055021 TGTTCTGGGCATTATCGGTAACA 60.055 43.478 0.00 0.0 0.00 2.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1064 1067 6.054941 TCTAATTCATTCAAGATAGGCGCAA 58.945 36.000 10.83 0.0 0.00 4.85
1103 1106 4.957296 AGTAACCGAAAGAGAAGCAAAGA 58.043 39.130 0.00 0.0 0.00 2.52
1310 1313 5.133221 AGTGCCAACTCAACAGATACTTTT 58.867 37.500 0.00 0.0 26.77 2.27
1333 1336 4.016444 GTGGCAAATCCCAGTCTTGATTA 58.984 43.478 0.00 0.0 35.05 1.75
1338 1341 2.206576 GAGTGGCAAATCCCAGTCTT 57.793 50.000 8.42 0.0 46.97 3.01
1607 1610 0.409092 TTGGCTCCCACATGTTCCAT 59.591 50.000 0.00 0.0 30.78 3.41
1895 1900 0.981277 CCTTCAGGTGGTCCCGGTAT 60.981 60.000 0.00 0.0 38.74 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.