Multiple sequence alignment - TraesCS5D01G148200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G148200 chr5D 100.000 2671 0 0 1 2671 235865980 235863310 0.000000e+00 4933.0
1 TraesCS5D01G148200 chr5D 96.567 1165 31 6 1 1158 236154376 236155538 0.000000e+00 1921.0
2 TraesCS5D01G148200 chr5D 92.683 205 14 1 1941 2144 235863928 235863724 7.230000e-76 294.0
3 TraesCS5D01G148200 chr5D 92.683 205 14 1 2053 2257 235864040 235863837 7.230000e-76 294.0
4 TraesCS5D01G148200 chr5D 89.177 231 15 5 2443 2669 395694232 395694008 2.020000e-71 279.0
5 TraesCS5D01G148200 chr5D 92.473 93 6 1 1941 2032 235863816 235863724 6.000000e-27 132.0
6 TraesCS5D01G148200 chr5D 92.473 93 6 1 2165 2257 235864040 235863949 6.000000e-27 132.0
7 TraesCS5D01G148200 chr5B 97.641 1399 21 4 1154 2550 269274878 269276266 0.000000e+00 2390.0
8 TraesCS5D01G148200 chr5B 98.631 1169 8 3 1154 2315 268856171 268855004 0.000000e+00 2063.0
9 TraesCS5D01G148200 chr5B 94.368 799 28 4 1 796 268858344 268857560 0.000000e+00 1210.0
10 TraesCS5D01G148200 chr5B 94.278 699 23 4 1 695 269272926 269273611 0.000000e+00 1053.0
11 TraesCS5D01G148200 chr5B 95.467 375 8 7 793 1158 268857515 268857141 8.240000e-165 590.0
12 TraesCS5D01G148200 chr5B 93.239 355 21 3 2318 2671 268811617 268811265 1.100000e-143 520.0
13 TraesCS5D01G148200 chr5B 89.474 361 29 8 2311 2671 268853194 268852843 5.250000e-122 448.0
14 TraesCS5D01G148200 chr5B 93.659 205 12 1 2053 2257 269275666 269275869 3.340000e-79 305.0
15 TraesCS5D01G148200 chr5B 93.659 205 12 1 1941 2144 269275778 269275982 3.340000e-79 305.0
16 TraesCS5D01G148200 chr5B 93.171 205 13 1 1941 2144 268855266 268855062 1.550000e-77 300.0
17 TraesCS5D01G148200 chr5B 93.171 205 12 2 2053 2257 268855377 268855175 1.550000e-77 300.0
18 TraesCS5D01G148200 chr5B 93.548 93 5 1 1941 2032 269275890 269275982 1.290000e-28 137.0
19 TraesCS5D01G148200 chr5B 92.473 93 6 1 1941 2032 268855154 268855062 6.000000e-27 132.0
20 TraesCS5D01G148200 chr5B 92.473 93 6 1 2165 2257 268855377 268855286 6.000000e-27 132.0
21 TraesCS5D01G148200 chr5B 92.473 93 6 1 2165 2257 269275666 269275757 6.000000e-27 132.0
22 TraesCS5D01G148200 chr5B 98.413 63 1 0 2229 2291 268811646 268811584 7.820000e-21 111.0
23 TraesCS5D01G148200 chrUn 89.256 242 17 5 2434 2671 223002271 223002035 7.230000e-76 294.0
24 TraesCS5D01G148200 chr3D 89.256 242 17 5 2434 2671 29493924 29493688 7.230000e-76 294.0
25 TraesCS5D01G148200 chr3D 88.843 242 18 5 2434 2671 29565793 29565557 3.360000e-74 289.0
26 TraesCS5D01G148200 chr3D 88.430 242 19 5 2434 2671 29528853 29528617 1.570000e-72 283.0
27 TraesCS5D01G148200 chr3B 88.017 242 20 4 2434 2671 417488886 417489122 7.280000e-71 278.0
28 TraesCS5D01G148200 chr1D 88.017 242 19 5 2434 2671 439108860 439108625 7.280000e-71 278.0
29 TraesCS5D01G148200 chr2B 93.333 45 3 0 113 157 197243281 197243237 1.720000e-07 67.6
30 TraesCS5D01G148200 chr2B 90.000 50 5 0 108 157 197242913 197242864 6.170000e-07 65.8
31 TraesCS5D01G148200 chr4A 94.595 37 2 0 121 157 646293031 646292995 1.030000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G148200 chr5D 235863310 235865980 2670 True 1157.000000 4933 94.062400 1 2671 5 chr5D.!!$R2 2670
1 TraesCS5D01G148200 chr5D 236154376 236155538 1162 False 1921.000000 1921 96.567000 1 1158 1 chr5D.!!$F1 1157
2 TraesCS5D01G148200 chr5B 269272926 269276266 3340 False 720.333333 2390 94.209667 1 2550 6 chr5B.!!$F1 2549
3 TraesCS5D01G148200 chr5B 268852843 268858344 5501 True 646.875000 2063 93.653500 1 2671 8 chr5B.!!$R2 2670

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
786 791 1.007848 CCTAGCATCAGATCGCTGCG 61.008 60.0 17.25 17.25 41.73 5.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2640 6257 0.182775 ATCATCCCCGGCCAAAGTAC 59.817 55.0 2.24 0.0 0.0 2.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
161 162 4.989168 CGTAAGTGTAGAGTTTTTGCTCCT 59.011 41.667 0.00 0.00 36.20 3.69
222 223 3.930144 TGGTATGGCCAAGGTGGT 58.070 55.556 10.96 0.00 45.94 4.16
238 239 2.819608 GGTGGTTGTGTGCATTAGTCAT 59.180 45.455 0.00 0.00 0.00 3.06
311 312 2.554893 GCCGGTCCATTTGTGTTTTCTA 59.445 45.455 1.90 0.00 0.00 2.10
582 584 6.282930 ACCATGCACCATTTTTCATTATAGC 58.717 36.000 0.00 0.00 0.00 2.97
707 712 6.064060 TGAGAATCCTGTGTGAACATTTCTT 58.936 36.000 0.00 0.00 0.00 2.52
738 743 6.410243 TTTTTGAGCTAAAAACAAAACCGG 57.590 33.333 8.60 0.00 41.88 5.28
786 791 1.007848 CCTAGCATCAGATCGCTGCG 61.008 60.000 17.25 17.25 41.73 5.18
877 1304 5.105064 GCATAACCCTAACCTAGAAGTGTCA 60.105 44.000 0.00 0.00 0.00 3.58
916 1343 1.971695 GCCTGTTGTTCCCCTTCCG 60.972 63.158 0.00 0.00 0.00 4.30
1462 3259 9.226606 TGGACTTGTACCATTTTACAGAATAAG 57.773 33.333 0.00 0.00 33.50 1.73
1658 3455 0.957395 AGCTGGAACATGTGAAGCCG 60.957 55.000 18.85 8.48 38.20 5.52
2048 3851 1.872952 CGATAAAGGCGATGGATGCAA 59.127 47.619 0.00 0.00 0.00 4.08
2205 4008 2.024414 GGCTTTACACATGATCCCACC 58.976 52.381 0.00 0.00 0.00 4.61
2355 5972 3.479269 CCGAAAGCACGAGTCGCC 61.479 66.667 13.59 3.88 33.46 5.54
2372 5989 2.747446 TCGCCAAGCCTAAATCAACTTC 59.253 45.455 0.00 0.00 0.00 3.01
2414 6031 5.863965 TGTTCATACTCACTGATTTGGACA 58.136 37.500 0.00 0.00 0.00 4.02
2574 6191 1.724429 TTACCCGCACGAACATTACC 58.276 50.000 0.00 0.00 0.00 2.85
2603 6220 3.734231 GGTTTTTAAAAGCGCCTTGAGTC 59.266 43.478 2.29 0.00 0.00 3.36
2610 6227 2.892425 CGCCTTGAGTCGCCCATC 60.892 66.667 0.00 0.00 0.00 3.51
2611 6228 2.268920 GCCTTGAGTCGCCCATCA 59.731 61.111 0.00 0.00 0.00 3.07
2640 6257 1.594862 GGAAGCCTTGATCGATGAACG 59.405 52.381 0.54 0.00 44.09 3.95
2652 6269 0.725117 GATGAACGTACTTTGGCCGG 59.275 55.000 0.00 0.00 0.00 6.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
95 96 1.078848 CGGACTCAGAAGGCAAGGG 60.079 63.158 0.00 0.00 28.86 3.95
161 162 8.185505 CGCTTTGTAGCTGGGTTATTTATTTTA 58.814 33.333 0.00 0.00 45.51 1.52
222 223 2.416202 CTGCGATGACTAATGCACACAA 59.584 45.455 0.00 0.00 33.12 3.33
261 262 0.391130 GCAACTATGTGGGCGAGTCA 60.391 55.000 0.00 0.00 0.00 3.41
369 371 7.172019 AGGACAAAATAAAACAGTGTAGTACCG 59.828 37.037 0.00 0.00 0.00 4.02
848 1275 3.965347 TCTAGGTTAGGGTTATGCAGACC 59.035 47.826 12.45 12.45 36.41 3.85
916 1343 0.242825 TGGAGACGGACGATGAACAC 59.757 55.000 0.00 0.00 0.00 3.32
1462 3259 4.816925 GCCATTCAGTACAGTATCCCTTTC 59.183 45.833 0.00 0.00 0.00 2.62
1658 3455 8.988934 TCATCAGTGTTAAACTAAATCAGACAC 58.011 33.333 0.00 0.00 36.83 3.67
2080 3883 6.707290 AGTGCAAGTAAAGTGGTATCATGTA 58.293 36.000 0.00 0.00 0.00 2.29
2355 5972 7.383300 CCAAAAAGAGAAGTTGATTTAGGCTTG 59.617 37.037 0.00 0.00 0.00 4.01
2372 5989 4.736126 ACAAGGTGTTTCCCAAAAAGAG 57.264 40.909 0.00 0.00 36.75 2.85
2574 6191 6.720012 AGGCGCTTTTAAAAACCATTATTG 57.280 33.333 7.64 0.00 0.00 1.90
2582 6199 3.420904 CGACTCAAGGCGCTTTTAAAAAC 59.579 43.478 7.64 0.00 0.00 2.43
2594 6211 0.960364 TTTGATGGGCGACTCAAGGC 60.960 55.000 0.00 0.00 33.25 4.35
2603 6220 3.578688 CTTCCTTTCTTTTTGATGGGCG 58.421 45.455 0.00 0.00 0.00 6.13
2610 6227 4.919754 CGATCAAGGCTTCCTTTCTTTTTG 59.080 41.667 0.00 0.00 41.69 2.44
2611 6228 4.827284 TCGATCAAGGCTTCCTTTCTTTTT 59.173 37.500 0.00 0.00 41.69 1.94
2640 6257 0.182775 ATCATCCCCGGCCAAAGTAC 59.817 55.000 2.24 0.00 0.00 2.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.