Multiple sequence alignment - TraesCS5D01G142700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G142700 chr5D 100.000 2543 0 0 1 2543 228646891 228644349 0.000000e+00 4697
1 TraesCS5D01G142700 chr7D 94.702 2548 119 7 1 2543 438129550 438127014 0.000000e+00 3943
2 TraesCS5D01G142700 chr7D 93.655 2569 126 14 1 2543 399253055 399250498 0.000000e+00 3807
3 TraesCS5D01G142700 chr2D 94.434 2551 122 9 1 2543 583243428 583245966 0.000000e+00 3906
4 TraesCS5D01G142700 chr2D 93.956 2548 138 8 1 2543 224181782 224184318 0.000000e+00 3838
5 TraesCS5D01G142700 chr2D 93.227 2569 136 13 1 2543 256138812 256136256 0.000000e+00 3746
6 TraesCS5D01G142700 chr6D 93.733 2553 137 15 1 2543 234463238 234465777 0.000000e+00 3807
7 TraesCS5D01G142700 chr4D 93.755 2530 139 8 20 2543 469727451 469729967 0.000000e+00 3779
8 TraesCS5D01G142700 chr4D 93.527 2549 148 8 1 2543 205581945 205584482 0.000000e+00 3777
9 TraesCS5D01G142700 chr3D 92.866 2551 163 9 1 2543 218460172 218462711 0.000000e+00 3685
10 TraesCS5D01G142700 chr3B 90.337 683 48 9 1 683 350076856 350077520 0.000000e+00 880
11 TraesCS5D01G142700 chr2A 93.671 158 10 0 1 158 211811103 211811260 1.180000e-58 237


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G142700 chr5D 228644349 228646891 2542 True 4697 4697 100.000 1 2543 1 chr5D.!!$R1 2542
1 TraesCS5D01G142700 chr7D 438127014 438129550 2536 True 3943 3943 94.702 1 2543 1 chr7D.!!$R2 2542
2 TraesCS5D01G142700 chr7D 399250498 399253055 2557 True 3807 3807 93.655 1 2543 1 chr7D.!!$R1 2542
3 TraesCS5D01G142700 chr2D 583243428 583245966 2538 False 3906 3906 94.434 1 2543 1 chr2D.!!$F2 2542
4 TraesCS5D01G142700 chr2D 224181782 224184318 2536 False 3838 3838 93.956 1 2543 1 chr2D.!!$F1 2542
5 TraesCS5D01G142700 chr2D 256136256 256138812 2556 True 3746 3746 93.227 1 2543 1 chr2D.!!$R1 2542
6 TraesCS5D01G142700 chr6D 234463238 234465777 2539 False 3807 3807 93.733 1 2543 1 chr6D.!!$F1 2542
7 TraesCS5D01G142700 chr4D 469727451 469729967 2516 False 3779 3779 93.755 20 2543 1 chr4D.!!$F2 2523
8 TraesCS5D01G142700 chr4D 205581945 205584482 2537 False 3777 3777 93.527 1 2543 1 chr4D.!!$F1 2542
9 TraesCS5D01G142700 chr3D 218460172 218462711 2539 False 3685 3685 92.866 1 2543 1 chr3D.!!$F1 2542
10 TraesCS5D01G142700 chr3B 350076856 350077520 664 False 880 880 90.337 1 683 1 chr3B.!!$F1 682

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
633 659 0.237235 GTTTCTCGGTTTGCATGCGA 59.763 50.0 14.09 8.74 0.0 5.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1559 1589 0.037326 CTCCTCAACTTAGTGCGCCA 60.037 55.0 4.18 0.0 0.0 5.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
493 518 4.464951 TGTCTGGCCTCGTTTAAATAGAGA 59.535 41.667 19.13 6.03 34.13 3.10
606 632 0.324614 TCATGAACGGACATGTGGCT 59.675 50.000 1.15 0.00 45.21 4.75
633 659 0.237235 GTTTCTCGGTTTGCATGCGA 59.763 50.000 14.09 8.74 0.00 5.10
909 939 3.627577 AGTTTGCACTCATATAAAGGCGG 59.372 43.478 0.00 0.00 0.00 6.13
1619 1652 2.224843 TGCATCTTTCTTCTTGCCTCCA 60.225 45.455 0.00 0.00 34.20 3.86
1751 1784 5.823312 TCACTGTAACTAGTACTCCATCCA 58.177 41.667 0.00 0.00 33.46 3.41
2181 2222 0.958091 TTGAAAGCAACCACATCCCG 59.042 50.000 0.00 0.00 0.00 5.14
2351 2394 3.181427 TGCCAGTAAAAGGAAAAGGCCTA 60.181 43.478 5.16 0.00 39.85 3.93
2398 2441 0.669077 CCAGGAATCGGGAGTACTCG 59.331 60.000 16.56 7.21 41.91 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
208 230 0.247736 GATGAGGAGTGGCGAGTTGT 59.752 55.000 0.00 0.00 0.00 3.32
299 321 0.321564 TGGTGCTTCATCAACCTCGG 60.322 55.000 0.00 0.00 0.00 4.63
493 518 2.362632 AAGCTCCTACCGTCCGCT 60.363 61.111 0.00 0.00 0.00 5.52
520 545 3.624959 GCCCTCAGTTTAAACTAGGCCAT 60.625 47.826 29.07 6.58 40.35 4.40
606 632 2.549349 GCAAACCGAGAAACCTACTCCA 60.549 50.000 0.00 0.00 0.00 3.86
633 659 3.418047 CATCAAACCCCTCCGTTAAACT 58.582 45.455 0.00 0.00 0.00 2.66
786 813 2.138656 GAGGATGCATCATTGGCCGC 62.139 60.000 27.25 8.35 0.00 6.53
832 862 2.478292 GTCCTCCTCCCATTACTTCCA 58.522 52.381 0.00 0.00 0.00 3.53
909 939 0.749049 GAAGCATTGGAATGGAGGGC 59.251 55.000 1.67 0.00 36.90 5.19
1253 1283 0.694444 ATGGAGGCCGATTAGGGTGT 60.694 55.000 0.00 0.00 41.48 4.16
1325 1355 1.630369 CCTCCAGGTGGACATTCTTCA 59.370 52.381 0.55 0.00 39.78 3.02
1559 1589 0.037326 CTCCTCAACTTAGTGCGCCA 60.037 55.000 4.18 0.00 0.00 5.69
1619 1652 0.108804 CGATCGCAGTGGTGGTTACT 60.109 55.000 0.26 0.00 0.00 2.24
1642 1675 6.017440 GCACAATAAGAATTAAGGCCACGATA 60.017 38.462 5.01 0.00 32.17 2.92
1941 1979 2.022764 TGGCACGATTGATCACGATT 57.977 45.000 12.18 0.00 0.00 3.34
1942 1980 1.935873 CTTGGCACGATTGATCACGAT 59.064 47.619 12.18 0.00 0.00 3.73
1943 1981 1.358877 CTTGGCACGATTGATCACGA 58.641 50.000 12.18 0.00 0.00 4.35
1944 1982 0.374758 CCTTGGCACGATTGATCACG 59.625 55.000 0.00 0.00 0.00 4.35
1945 1983 1.667724 CTCCTTGGCACGATTGATCAC 59.332 52.381 0.00 0.00 0.00 3.06
1946 1984 2.013563 GCTCCTTGGCACGATTGATCA 61.014 52.381 0.00 0.00 0.00 2.92
1947 1985 0.659957 GCTCCTTGGCACGATTGATC 59.340 55.000 0.00 0.00 0.00 2.92
1948 1986 1.091771 CGCTCCTTGGCACGATTGAT 61.092 55.000 0.00 0.00 0.00 2.57
1949 1987 1.741401 CGCTCCTTGGCACGATTGA 60.741 57.895 0.00 0.00 0.00 2.57
1950 1988 2.753966 CCGCTCCTTGGCACGATTG 61.754 63.158 0.00 0.00 0.00 2.67
1951 1989 2.436646 CCGCTCCTTGGCACGATT 60.437 61.111 0.00 0.00 0.00 3.34
2086 2127 2.949177 TGCCACAACTTACCTCACAT 57.051 45.000 0.00 0.00 0.00 3.21
2181 2222 1.200948 GCTGTTTTGATGAGTGAGGGC 59.799 52.381 0.00 0.00 0.00 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.