Multiple sequence alignment - TraesCS5D01G135200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G135200 chr5D 100.000 2513 0 0 1 2513 215554604 215552092 0.000000e+00 4641.0
1 TraesCS5D01G135200 chr4D 97.421 2482 58 4 1 2478 329901382 329903861 0.000000e+00 4224.0
2 TraesCS5D01G135200 chr4D 97.146 2488 63 6 1 2483 280140038 280142522 0.000000e+00 4194.0
3 TraesCS5D01G135200 chr4D 96.906 2489 68 7 1 2483 277288213 277290698 0.000000e+00 4161.0
4 TraesCS5D01G135200 chr4D 96.850 127 3 1 2357 2483 67957834 67957709 7.040000e-51 211.0
5 TraesCS5D01G135200 chr4D 100.000 33 0 0 2481 2513 532613 532645 7.510000e-06 62.1
6 TraesCS5D01G135200 chr4D 100.000 33 0 0 2481 2513 67957627 67957595 7.510000e-06 62.1
7 TraesCS5D01G135200 chr4D 100.000 33 0 0 2481 2513 90520010 90519978 7.510000e-06 62.1
8 TraesCS5D01G135200 chr4D 100.000 33 0 0 2481 2513 90554563 90554531 7.510000e-06 62.1
9 TraesCS5D01G135200 chr4D 100.000 33 0 0 2481 2513 280142604 280142636 7.510000e-06 62.1
10 TraesCS5D01G135200 chr4D 100.000 33 0 0 2481 2513 313382089 313382057 7.510000e-06 62.1
11 TraesCS5D01G135200 chr4D 100.000 33 0 0 2481 2513 403263527 403263559 7.510000e-06 62.1
12 TraesCS5D01G135200 chr1D 97.066 2488 61 8 1 2483 466981855 466979375 0.000000e+00 4180.0
13 TraesCS5D01G135200 chr1D 97.264 2376 58 5 1 2371 39392150 39389777 0.000000e+00 4021.0
14 TraesCS5D01G135200 chr1D 96.880 2372 55 10 1 2365 78958017 78960376 0.000000e+00 3952.0
15 TraesCS5D01G135200 chr7D 97.064 2486 61 7 1 2483 404002741 404005217 0.000000e+00 4176.0
16 TraesCS5D01G135200 chr3D 95.691 2483 72 14 1 2478 42216039 42213587 0.000000e+00 3960.0
17 TraesCS5D01G135200 chr2D 96.800 2375 68 6 1 2371 118670697 118668327 0.000000e+00 3958.0
18 TraesCS5D01G135200 chr2B 96.063 127 5 0 2357 2483 138502867 138502993 9.110000e-50 207.0
19 TraesCS5D01G135200 chr6B 95.349 129 6 0 2357 2485 456801398 456801526 3.280000e-49 206.0
20 TraesCS5D01G135200 chr5B 95.349 129 6 0 2357 2485 342384997 342385125 3.280000e-49 206.0
21 TraesCS5D01G135200 chrUn 100.000 33 0 0 2481 2513 111088916 111088884 7.510000e-06 62.1
22 TraesCS5D01G135200 chrUn 100.000 33 0 0 2481 2513 478138882 478138850 7.510000e-06 62.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G135200 chr5D 215552092 215554604 2512 True 4641.00 4641 100.000 1 2513 1 chr5D.!!$R1 2512
1 TraesCS5D01G135200 chr4D 329901382 329903861 2479 False 4224.00 4224 97.421 1 2478 1 chr4D.!!$F3 2477
2 TraesCS5D01G135200 chr4D 277288213 277290698 2485 False 4161.00 4161 96.906 1 2483 1 chr4D.!!$F2 2482
3 TraesCS5D01G135200 chr4D 280140038 280142636 2598 False 2128.05 4194 98.573 1 2513 2 chr4D.!!$F5 2512
4 TraesCS5D01G135200 chr1D 466979375 466981855 2480 True 4180.00 4180 97.066 1 2483 1 chr1D.!!$R2 2482
5 TraesCS5D01G135200 chr1D 39389777 39392150 2373 True 4021.00 4021 97.264 1 2371 1 chr1D.!!$R1 2370
6 TraesCS5D01G135200 chr1D 78958017 78960376 2359 False 3952.00 3952 96.880 1 2365 1 chr1D.!!$F1 2364
7 TraesCS5D01G135200 chr7D 404002741 404005217 2476 False 4176.00 4176 97.064 1 2483 1 chr7D.!!$F1 2482
8 TraesCS5D01G135200 chr3D 42213587 42216039 2452 True 3960.00 3960 95.691 1 2478 1 chr3D.!!$R1 2477
9 TraesCS5D01G135200 chr2D 118668327 118670697 2370 True 3958.00 3958 96.800 1 2371 1 chr2D.!!$R1 2370

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
500 515 0.981183 TGACTTGCTCATAACCCCGT 59.019 50.0 0.0 0.0 0.0 5.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2398 2430 1.135199 GCGGATAAGGTGAAGACGACA 60.135 52.381 0.0 0.0 0.0 4.35 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 133 4.901785 AACCCTCTCTCCCTATTCTACA 57.098 45.455 0.00 0.0 0.00 2.74
131 136 5.212745 ACCCTCTCTCCCTATTCTACAAAG 58.787 45.833 0.00 0.0 0.00 2.77
165 170 6.763135 TGTTCATAGGTGATAGCTCATTTGTC 59.237 38.462 0.00 0.0 33.56 3.18
207 212 9.747898 TGAAAATGACCTACACCAAGTTTATAT 57.252 29.630 0.00 0.0 0.00 0.86
269 277 5.925397 TGCGCAAGAATTACAACATTTTGAT 59.075 32.000 8.16 0.0 43.02 2.57
396 408 5.895534 TGGTAACTAGGTCTCATAAACGGAT 59.104 40.000 0.00 0.0 37.61 4.18
500 515 0.981183 TGACTTGCTCATAACCCCGT 59.019 50.000 0.00 0.0 0.00 5.28
516 531 2.618045 CCCCGTAGAAATGCTCCAAACT 60.618 50.000 0.00 0.0 0.00 2.66
585 601 2.611800 TCAGATGTGGGGCAGGCT 60.612 61.111 0.00 0.0 0.00 4.58
863 880 2.085320 TCTCGTTCTTCTTCCTCTCGG 58.915 52.381 0.00 0.0 0.00 4.63
964 981 2.752238 CGACCTCCTCGTCAGCCT 60.752 66.667 0.00 0.0 37.64 4.58
992 1009 2.987125 GTGGCCGGTGTATGGTCT 59.013 61.111 1.90 0.0 30.50 3.85
1311 1328 0.451783 GGAATGCAATCCGCGAGTTT 59.548 50.000 8.23 0.0 46.97 2.66
1618 1635 7.383572 GTCGATCTCTGAATGTATGCAGTTTAT 59.616 37.037 0.00 0.0 33.90 1.40
1723 1740 4.040755 AGTGTTGGATCATACCCTAGCTT 58.959 43.478 0.00 0.0 0.00 3.74
1753 1770 2.036733 ACAGTAAGCGGTACTTGAGCAA 59.963 45.455 0.79 0.0 41.37 3.91
1759 1776 1.535462 GCGGTACTTGAGCAACACAAT 59.465 47.619 0.00 0.0 0.00 2.71
2297 2328 3.754965 ACATAGCTCTCAAACCAAAGCA 58.245 40.909 0.00 0.0 37.22 3.91
2398 2430 0.108585 AACACCGCCATGTCTTCACT 59.891 50.000 0.00 0.0 30.55 3.41
2414 2446 4.523173 TCTTCACTGTCGTCTTCACCTTAT 59.477 41.667 0.00 0.0 0.00 1.73
2478 2510 1.371183 CTCCTCAAGGCCGTTGTCA 59.629 57.895 12.71 0.0 37.43 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
500 515 5.420725 TGCTAGAGTTTGGAGCATTTCTA 57.579 39.130 0.00 0.00 41.18 2.10
516 531 1.063649 GCGGACGTTCGATGCTAGA 59.936 57.895 23.04 0.00 0.00 2.43
817 834 4.814967 TGGGGAAAGAAACAGAGGAATTT 58.185 39.130 0.00 0.00 0.00 1.82
863 880 3.056536 GGGAAAGAAACAGAGGAATTGCC 60.057 47.826 0.00 0.00 0.00 4.52
1044 1061 4.090090 TCTTCTCCTCCTTCGAAGTCAAT 58.910 43.478 23.03 0.00 36.44 2.57
1311 1328 1.408683 GCACTGTCATGGGGCAGATTA 60.409 52.381 15.97 0.00 36.62 1.75
1618 1635 9.545611 GAAACTAAAAGTGTCGAAACTTAACAA 57.454 29.630 21.13 6.61 39.48 2.83
1638 1655 3.746045 AGTTGTCTTCTGCCGAAACTA 57.254 42.857 0.00 0.00 0.00 2.24
1723 1740 6.783207 AAGTACCGCTTACTGTCATCTGACA 61.783 44.000 12.18 12.18 43.08 3.58
1741 1758 3.146066 TCCATTGTGTTGCTCAAGTACC 58.854 45.455 0.00 0.00 0.00 3.34
1753 1770 8.985315 ATGAACTTGATGTATATCCATTGTGT 57.015 30.769 0.00 0.00 32.09 3.72
1759 1776 9.152327 AGAAGAGATGAACTTGATGTATATCCA 57.848 33.333 0.00 0.00 32.09 3.41
2279 2310 3.141398 CACTGCTTTGGTTTGAGAGCTA 58.859 45.455 0.00 0.00 36.16 3.32
2398 2430 1.135199 GCGGATAAGGTGAAGACGACA 60.135 52.381 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.