Multiple sequence alignment - TraesCS5D01G134700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G134700 chr5D 100.000 3034 0 0 1 3034 214920674 214917641 0.000000e+00 5603.0
1 TraesCS5D01G134700 chr5B 97.951 2635 36 6 1 2632 230249521 230246902 0.000000e+00 4551.0
2 TraesCS5D01G134700 chr5B 100.000 390 0 0 2645 3034 230246810 230246421 0.000000e+00 721.0
3 TraesCS5D01G134700 chr5B 94.118 85 5 0 580 664 36727196 36727280 2.450000e-26 130.0
4 TraesCS5D01G134700 chr5B 96.552 58 2 0 2587 2644 230246916 230246859 2.490000e-16 97.1
5 TraesCS5D01G134700 chr5A 96.221 2646 55 10 2 2632 282588939 282586324 0.000000e+00 4290.0
6 TraesCS5D01G134700 chr5A 97.098 448 9 2 2587 3034 282586338 282585895 0.000000e+00 752.0
7 TraesCS5D01G134700 chr2D 87.766 3147 219 75 27 3034 567476248 567479367 0.000000e+00 3526.0
8 TraesCS5D01G134700 chr2B 88.737 2699 182 53 27 2632 680192918 680195587 0.000000e+00 3188.0
9 TraesCS5D01G134700 chr2B 92.334 287 18 3 2752 3034 680195788 680196074 3.640000e-109 405.0
10 TraesCS5D01G134700 chr2A 89.293 1952 132 34 729 2631 706994904 706996827 0.000000e+00 2375.0
11 TraesCS5D01G134700 chr2A 89.252 428 23 11 326 731 706994352 706994778 5.800000e-142 514.0
12 TraesCS5D01G134700 chr2A 89.459 351 23 8 27 364 706994006 706994355 6.010000e-117 431.0
13 TraesCS5D01G134700 chr2A 92.933 283 20 0 2752 3034 706996986 706997268 2.180000e-111 412.0
14 TraesCS5D01G134700 chrUn 100.000 390 0 0 2645 3034 476965435 476965824 0.000000e+00 721.0
15 TraesCS5D01G134700 chr4B 79.898 781 99 39 677 1431 135211084 135211832 1.250000e-143 520.0
16 TraesCS5D01G134700 chr4B 83.978 181 14 5 529 695 135210867 135211046 3.130000e-35 159.0
17 TraesCS5D01G134700 chr4D 82.587 603 75 21 842 1431 95780931 95781516 3.490000e-139 505.0
18 TraesCS5D01G134700 chr4D 87.234 141 12 3 529 664 95780563 95780702 4.050000e-34 156.0
19 TraesCS5D01G134700 chr4A 82.616 604 72 20 845 1431 483951563 483950976 1.260000e-138 503.0
20 TraesCS5D01G134700 chr4A 86.861 137 11 4 534 664 483951949 483951814 2.440000e-31 147.0
21 TraesCS5D01G134700 chr3D 81.550 271 43 5 1097 1362 362069952 362069684 1.830000e-52 217.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G134700 chr5D 214917641 214920674 3033 True 5603.0 5603 100.000000 1 3034 1 chr5D.!!$R1 3033
1 TraesCS5D01G134700 chr5B 230246421 230249521 3100 True 1789.7 4551 98.167667 1 3034 3 chr5B.!!$R1 3033
2 TraesCS5D01G134700 chr5A 282585895 282588939 3044 True 2521.0 4290 96.659500 2 3034 2 chr5A.!!$R1 3032
3 TraesCS5D01G134700 chr2D 567476248 567479367 3119 False 3526.0 3526 87.766000 27 3034 1 chr2D.!!$F1 3007
4 TraesCS5D01G134700 chr2B 680192918 680196074 3156 False 1796.5 3188 90.535500 27 3034 2 chr2B.!!$F1 3007
5 TraesCS5D01G134700 chr2A 706994006 706997268 3262 False 933.0 2375 90.234250 27 3034 4 chr2A.!!$F1 3007
6 TraesCS5D01G134700 chr4B 135210867 135211832 965 False 339.5 520 81.938000 529 1431 2 chr4B.!!$F1 902
7 TraesCS5D01G134700 chr4D 95780563 95781516 953 False 330.5 505 84.910500 529 1431 2 chr4D.!!$F1 902
8 TraesCS5D01G134700 chr4A 483950976 483951949 973 True 325.0 503 84.738500 534 1431 2 chr4A.!!$R1 897

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
465 555 1.523758 CACTGCAGTACCAGAAACCC 58.476 55.000 21.2 0.0 36.67 4.11 F
1535 1896 2.029828 GCACGTCAGGATCATACCCTAG 60.030 54.545 0.0 0.0 31.64 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1569 1930 0.390866 CGCTGTGATCTTGCTCCACT 60.391 55.00 0.0 0.0 0.0 4.00 R
2421 2826 4.973168 ACTTCATAGCTTGTTCTTGGACA 58.027 39.13 0.0 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
41 42 2.103094 TGAGACTGTGAGTCCAACCAAG 59.897 50.000 0.01 0.0 46.18 3.61
90 96 3.403038 CTTGTCCTCTTAACAGGTGGTG 58.597 50.000 0.00 0.0 34.76 4.17
350 385 3.638160 ACCTCCGTGTCTACACAAGTTAA 59.362 43.478 13.30 0.0 46.75 2.01
374 445 3.565764 TGGCATGGACTCTTATTGGAG 57.434 47.619 0.00 0.0 39.09 3.86
465 555 1.523758 CACTGCAGTACCAGAAACCC 58.476 55.000 21.20 0.0 36.67 4.11
505 599 7.523415 AGGTTAAAATGAGGAGTTAAGGACAA 58.477 34.615 0.00 0.0 0.00 3.18
1535 1896 2.029828 GCACGTCAGGATCATACCCTAG 60.030 54.545 0.00 0.0 31.64 3.02
1569 1930 2.903350 TACGCCTATCGCCGCTCA 60.903 61.111 0.00 0.0 43.23 4.26
1685 2054 7.491372 TGTGCTGAAAATTACCTATCTCTTACG 59.509 37.037 0.00 0.0 0.00 3.18
1686 2055 7.705325 GTGCTGAAAATTACCTATCTCTTACGA 59.295 37.037 0.00 0.0 0.00 3.43
1687 2056 7.705325 TGCTGAAAATTACCTATCTCTTACGAC 59.295 37.037 0.00 0.0 0.00 4.34
1688 2057 7.921745 GCTGAAAATTACCTATCTCTTACGACT 59.078 37.037 0.00 0.0 0.00 4.18
1689 2058 9.804758 CTGAAAATTACCTATCTCTTACGACTT 57.195 33.333 0.00 0.0 0.00 3.01
2177 2568 3.329225 AGGAAAAGGAAGAGGAAGTGGAG 59.671 47.826 0.00 0.0 0.00 3.86
2421 2826 7.404671 TGTATGTGTCATCTGTATGTAGTGT 57.595 36.000 0.00 0.0 34.50 3.55
2560 2979 0.734253 GTGCTCTACACCTCACGCAG 60.734 60.000 0.00 0.0 44.02 5.18
2607 3027 6.038356 GTCAAATTCAATGCATTCACCCTAG 58.962 40.000 9.53 0.0 0.00 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
90 96 3.943381 TGTCTCATTGAATGACATGGCTC 59.057 43.478 3.29 0.00 36.03 4.70
350 385 5.271598 TCCAATAAGAGTCCATGCCATTTT 58.728 37.500 0.00 0.00 0.00 1.82
505 599 4.454678 CAGTGTGATGTAAGTATGGCCAT 58.545 43.478 24.45 24.45 0.00 4.40
803 1123 3.533547 AGGTGTCTAGCTAGTGTCTACG 58.466 50.000 20.10 0.00 31.69 3.51
1503 1864 2.143122 CCTGACGTGCTGTAACACATT 58.857 47.619 0.00 0.00 40.73 2.71
1569 1930 0.390866 CGCTGTGATCTTGCTCCACT 60.391 55.000 0.00 0.00 0.00 4.00
1736 2106 3.426568 GTGCTGCTCTTGGCGTCC 61.427 66.667 0.00 0.00 45.43 4.79
1961 2334 8.974060 TGAGAAATTTGGTTATATGTCCTACC 57.026 34.615 0.00 0.00 0.00 3.18
2177 2568 4.657952 CCGGGAAACAAGGGATCC 57.342 61.111 1.92 1.92 0.00 3.36
2421 2826 4.973168 ACTTCATAGCTTGTTCTTGGACA 58.027 39.130 0.00 0.00 0.00 4.02
2560 2979 9.092876 TGACTTGAAAACATTAAACCAATTGAC 57.907 29.630 7.12 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.