Multiple sequence alignment - TraesCS5D01G134300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G134300 chr5D 100.000 2482 0 0 1 2482 214355605 214358086 0.000000e+00 4584
1 TraesCS5D01G134300 chr5D 99.869 1529 2 0 633 2161 58662975 58661447 0.000000e+00 2813
2 TraesCS5D01G134300 chr5D 99.804 1528 3 0 630 2157 172016764 172018291 0.000000e+00 2806
3 TraesCS5D01G134300 chr5D 99.868 1520 2 0 640 2159 548974533 548976052 0.000000e+00 2796
4 TraesCS5D01G134300 chr5D 91.406 640 43 8 1 631 493570665 493571301 0.000000e+00 867
5 TraesCS5D01G134300 chr5D 89.706 340 11 2 2166 2482 493583142 493583480 1.780000e-111 412
6 TraesCS5D01G134300 chr6D 99.935 1534 1 0 630 2163 9960132 9961665 0.000000e+00 2828
7 TraesCS5D01G134300 chr6D 99.737 1523 4 0 640 2162 450086796 450085274 0.000000e+00 2791
8 TraesCS5D01G134300 chr2D 99.804 1532 3 0 630 2161 9253343 9254874 0.000000e+00 2813
9 TraesCS5D01G134300 chr2D 99.804 1531 3 0 630 2160 30789471 30791001 0.000000e+00 2811
10 TraesCS5D01G134300 chr2D 88.095 210 19 4 2211 2416 642409972 642409765 6.860000e-61 244
11 TraesCS5D01G134300 chr3D 99.868 1520 2 0 640 2159 558743763 558742244 0.000000e+00 2796
12 TraesCS5D01G134300 chrUn 99.803 1521 3 0 639 2159 126794672 126796192 0.000000e+00 2793
13 TraesCS5D01G134300 chrUn 89.776 313 27 5 1 311 41891025 41891334 1.790000e-106 396
14 TraesCS5D01G134300 chr7A 88.226 637 41 17 1 636 735022168 735021565 0.000000e+00 730
15 TraesCS5D01G134300 chr7A 95.963 322 13 0 2161 2482 735021577 735021256 7.860000e-145 523
16 TraesCS5D01G134300 chr7A 92.636 258 17 2 93 350 151382409 151382154 1.080000e-98 370
17 TraesCS5D01G134300 chr1B 92.945 326 19 1 2161 2482 129143382 129143057 2.890000e-129 472
18 TraesCS5D01G134300 chr1B 89.531 277 26 2 362 636 129143645 129143370 5.080000e-92 348
19 TraesCS5D01G134300 chr4B 83.792 327 18 14 2161 2482 621963920 621964216 6.760000e-71 278
20 TraesCS5D01G134300 chr1D 87.143 210 21 4 2211 2416 493352014 493351807 1.480000e-57 233
21 TraesCS5D01G134300 chr5B 86.667 210 22 4 2211 2416 48858137 48858344 6.910000e-56 228
22 TraesCS5D01G134300 chr4D 85.646 209 23 5 2214 2416 439128677 439128884 1.930000e-51 213


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G134300 chr5D 214355605 214358086 2481 False 4584.0 4584 100.0000 1 2482 1 chr5D.!!$F2 2481
1 TraesCS5D01G134300 chr5D 58661447 58662975 1528 True 2813.0 2813 99.8690 633 2161 1 chr5D.!!$R1 1528
2 TraesCS5D01G134300 chr5D 172016764 172018291 1527 False 2806.0 2806 99.8040 630 2157 1 chr5D.!!$F1 1527
3 TraesCS5D01G134300 chr5D 548974533 548976052 1519 False 2796.0 2796 99.8680 640 2159 1 chr5D.!!$F5 1519
4 TraesCS5D01G134300 chr5D 493570665 493571301 636 False 867.0 867 91.4060 1 631 1 chr5D.!!$F3 630
5 TraesCS5D01G134300 chr6D 9960132 9961665 1533 False 2828.0 2828 99.9350 630 2163 1 chr6D.!!$F1 1533
6 TraesCS5D01G134300 chr6D 450085274 450086796 1522 True 2791.0 2791 99.7370 640 2162 1 chr6D.!!$R1 1522
7 TraesCS5D01G134300 chr2D 9253343 9254874 1531 False 2813.0 2813 99.8040 630 2161 1 chr2D.!!$F1 1531
8 TraesCS5D01G134300 chr2D 30789471 30791001 1530 False 2811.0 2811 99.8040 630 2160 1 chr2D.!!$F2 1530
9 TraesCS5D01G134300 chr3D 558742244 558743763 1519 True 2796.0 2796 99.8680 640 2159 1 chr3D.!!$R1 1519
10 TraesCS5D01G134300 chrUn 126794672 126796192 1520 False 2793.0 2793 99.8030 639 2159 1 chrUn.!!$F2 1520
11 TraesCS5D01G134300 chr7A 735021256 735022168 912 True 626.5 730 92.0945 1 2482 2 chr7A.!!$R2 2481
12 TraesCS5D01G134300 chr1B 129143057 129143645 588 True 410.0 472 91.2380 362 2482 2 chr1B.!!$R1 2120

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
30 31 0.179004 AATCACGGAACAAGCCACCA 60.179 50.0 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2169 2181 2.092753 GCAATGGTCTCTCCTCCATCAA 60.093 50.0 0.0 0.0 42.73 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 0.179004 AATCACGGAACAAGCCACCA 60.179 50.000 0.00 0.00 0.00 4.17
75 76 1.534811 GAAAGAACACGCGTCGTCGT 61.535 55.000 9.86 4.88 44.35 4.34
104 105 3.434310 CCTGGCTTCTCTTATCCTTTCCC 60.434 52.174 0.00 0.00 0.00 3.97
107 108 2.780592 GCTTCTCTTATCCTTTCCCCCT 59.219 50.000 0.00 0.00 0.00 4.79
189 190 1.299014 CTCCATCTCGAGCTCGTGC 60.299 63.158 33.33 0.07 40.80 5.34
246 247 2.505118 GAGCTCGTGCAGGTCGTC 60.505 66.667 12.58 0.00 39.82 4.20
525 535 1.004320 TCGCCAATGCAACGGTACT 60.004 52.632 6.63 0.00 37.32 2.73
535 545 0.511221 CAACGGTACTTGCAACTCCG 59.489 55.000 22.25 22.25 45.53 4.63
597 609 6.601613 AGATGTTCAGTTTTGTTGTTGTCCTA 59.398 34.615 0.00 0.00 0.00 2.94
2257 2269 9.623350 GCCATTGCAAATTTTATTTTATGTTGT 57.377 25.926 1.71 0.00 37.47 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
66 67 3.849953 GGGCATTCACGACGACGC 61.850 66.667 7.30 0.0 43.96 5.19
75 76 0.700564 AAGAGAAGCCAGGGCATTCA 59.299 50.000 13.63 0.0 44.88 2.57
79 80 0.839946 GGATAAGAGAAGCCAGGGCA 59.160 55.000 13.63 0.0 44.88 5.36
104 105 0.400594 AGACTCGTTGGGGAAAAGGG 59.599 55.000 0.00 0.0 0.00 3.95
107 108 2.037251 CTGAGAGACTCGTTGGGGAAAA 59.963 50.000 0.00 0.0 32.35 2.29
358 368 3.790437 AGCCGCCATGACCTCCAG 61.790 66.667 0.00 0.0 0.00 3.86
535 545 3.097614 AGTAGGTGTGTGATGTAGGGAC 58.902 50.000 0.00 0.0 0.00 4.46
597 609 6.923508 GGCAACTTAAACAAAGCTAGTTCAAT 59.076 34.615 5.09 0.0 38.93 2.57
2163 2175 3.964031 GGTCTCTCCTCCATCAACTACAT 59.036 47.826 0.00 0.0 0.00 2.29
2164 2176 3.245622 TGGTCTCTCCTCCATCAACTACA 60.246 47.826 0.00 0.0 37.07 2.74
2165 2177 3.366396 TGGTCTCTCCTCCATCAACTAC 58.634 50.000 0.00 0.0 37.07 2.73
2166 2178 3.757947 TGGTCTCTCCTCCATCAACTA 57.242 47.619 0.00 0.0 37.07 2.24
2167 2179 2.630889 TGGTCTCTCCTCCATCAACT 57.369 50.000 0.00 0.0 37.07 3.16
2168 2180 3.539604 CAATGGTCTCTCCTCCATCAAC 58.460 50.000 0.00 0.0 42.73 3.18
2169 2181 2.092753 GCAATGGTCTCTCCTCCATCAA 60.093 50.000 0.00 0.0 42.73 2.57
2170 2182 1.487976 GCAATGGTCTCTCCTCCATCA 59.512 52.381 0.00 0.0 42.73 3.07
2171 2183 1.487976 TGCAATGGTCTCTCCTCCATC 59.512 52.381 0.00 0.0 42.73 3.51
2172 2184 1.588239 TGCAATGGTCTCTCCTCCAT 58.412 50.000 0.00 0.0 45.06 3.41
2252 2264 8.893219 TTTACAATAAATTTGCCATGACAACA 57.107 26.923 0.00 0.0 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.