Multiple sequence alignment - TraesCS5D01G125200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G125200 chr5D 100.000 3084 0 0 1 3084 191265151 191262068 0.000000e+00 5696
1 TraesCS5D01G125200 chr5D 97.408 3087 52 11 1 3084 196348943 196352004 0.000000e+00 5232
2 TraesCS5D01G125200 chr2B 92.800 3125 163 25 1 3084 424323381 424320278 0.000000e+00 4468
3 TraesCS5D01G125200 chr5B 92.647 3128 166 26 1 3084 323887929 323891036 0.000000e+00 4444
4 TraesCS5D01G125200 chr5B 94.880 2422 109 5 673 3084 37707377 37704961 0.000000e+00 3771
5 TraesCS5D01G125200 chr1A 92.443 3123 175 26 1 3084 208685529 208682429 0.000000e+00 4403
6 TraesCS5D01G125200 chrUn 94.302 2422 108 6 673 3084 65726027 65723626 0.000000e+00 3681
7 TraesCS5D01G125200 chr2A 97.340 1955 47 4 1 1952 475806891 475804939 0.000000e+00 3317
8 TraesCS5D01G125200 chr2A 97.897 1141 24 0 1944 3084 475796841 475795701 0.000000e+00 1975
9 TraesCS5D01G125200 chr6D 88.589 2559 218 40 564 3084 273041762 273039240 0.000000e+00 3040
10 TraesCS5D01G125200 chr6D 93.243 296 10 2 230 515 65355022 65355317 7.900000e-116 427
11 TraesCS5D01G125200 chr4B 85.242 2270 288 35 820 3084 299747685 299745458 0.000000e+00 2292
12 TraesCS5D01G125200 chr4B 93.226 620 27 8 1 608 34780516 34781132 0.000000e+00 898
13 TraesCS5D01G125200 chr3B 92.134 1284 52 22 1 1261 822688089 822689346 0.000000e+00 1766
14 TraesCS5D01G125200 chr3B 93.194 573 27 7 318 879 600470278 600469707 0.000000e+00 832
15 TraesCS5D01G125200 chr6A 88.153 1072 105 8 2014 3084 390575403 390574353 0.000000e+00 1256
16 TraesCS5D01G125200 chr6A 86.443 627 52 12 103 706 83464120 83463504 0.000000e+00 656
17 TraesCS5D01G125200 chr3D 94.431 808 32 5 1 796 54837830 54837024 0.000000e+00 1230
18 TraesCS5D01G125200 chr7B 93.695 571 23 8 318 876 634168326 634168895 0.000000e+00 843


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G125200 chr5D 191262068 191265151 3083 True 5696 5696 100.000 1 3084 1 chr5D.!!$R1 3083
1 TraesCS5D01G125200 chr5D 196348943 196352004 3061 False 5232 5232 97.408 1 3084 1 chr5D.!!$F1 3083
2 TraesCS5D01G125200 chr2B 424320278 424323381 3103 True 4468 4468 92.800 1 3084 1 chr2B.!!$R1 3083
3 TraesCS5D01G125200 chr5B 323887929 323891036 3107 False 4444 4444 92.647 1 3084 1 chr5B.!!$F1 3083
4 TraesCS5D01G125200 chr5B 37704961 37707377 2416 True 3771 3771 94.880 673 3084 1 chr5B.!!$R1 2411
5 TraesCS5D01G125200 chr1A 208682429 208685529 3100 True 4403 4403 92.443 1 3084 1 chr1A.!!$R1 3083
6 TraesCS5D01G125200 chrUn 65723626 65726027 2401 True 3681 3681 94.302 673 3084 1 chrUn.!!$R1 2411
7 TraesCS5D01G125200 chr2A 475804939 475806891 1952 True 3317 3317 97.340 1 1952 1 chr2A.!!$R2 1951
8 TraesCS5D01G125200 chr2A 475795701 475796841 1140 True 1975 1975 97.897 1944 3084 1 chr2A.!!$R1 1140
9 TraesCS5D01G125200 chr6D 273039240 273041762 2522 True 3040 3040 88.589 564 3084 1 chr6D.!!$R1 2520
10 TraesCS5D01G125200 chr4B 299745458 299747685 2227 True 2292 2292 85.242 820 3084 1 chr4B.!!$R1 2264
11 TraesCS5D01G125200 chr4B 34780516 34781132 616 False 898 898 93.226 1 608 1 chr4B.!!$F1 607
12 TraesCS5D01G125200 chr3B 822688089 822689346 1257 False 1766 1766 92.134 1 1261 1 chr3B.!!$F1 1260
13 TraesCS5D01G125200 chr3B 600469707 600470278 571 True 832 832 93.194 318 879 1 chr3B.!!$R1 561
14 TraesCS5D01G125200 chr6A 390574353 390575403 1050 True 1256 1256 88.153 2014 3084 1 chr6A.!!$R2 1070
15 TraesCS5D01G125200 chr6A 83463504 83464120 616 True 656 656 86.443 103 706 1 chr6A.!!$R1 603
16 TraesCS5D01G125200 chr3D 54837024 54837830 806 True 1230 1230 94.431 1 796 1 chr3D.!!$R1 795
17 TraesCS5D01G125200 chr7B 634168326 634168895 569 False 843 843 93.695 318 876 1 chr7B.!!$F1 558

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
133 135 4.719369 GAGCGCCCTTGACGTCGT 62.719 66.667 11.62 0.0 0.00 4.34 F
820 893 4.744570 TCGATCTATTTCTCGCACTTGTT 58.255 39.130 0.00 0.0 34.94 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1794 1901 4.155644 GCATTTCTTCTTCCCTCACAGAAG 59.844 45.833 3.00 3.00 45.15 2.85 R
2480 2599 1.032114 TCTCTCAATGAGCGGCGAGA 61.032 55.000 12.98 0.77 42.38 4.04 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 135 4.719369 GAGCGCCCTTGACGTCGT 62.719 66.667 11.62 0.00 0.00 4.34
206 213 5.084818 TCTCGCAAACCAATTCTATCTCA 57.915 39.130 0.00 0.00 0.00 3.27
777 850 8.041919 TGATGTACGTCCTGGTTAAATTAATCA 58.958 33.333 12.54 0.00 0.00 2.57
790 863 7.986889 GGTTAAATTAATCATGCCATTGAAGGT 59.013 33.333 0.00 0.00 0.00 3.50
820 893 4.744570 TCGATCTATTTCTCGCACTTGTT 58.255 39.130 0.00 0.00 34.94 2.83
1305 1385 6.315393 ACAAACCATTTCCGTACTATGATGTC 59.685 38.462 0.00 0.00 0.00 3.06
1328 1408 9.342308 TGTCCTATATGAAATTCATGAAGGTTC 57.658 33.333 24.86 20.27 39.32 3.62
1517 1598 7.147828 GCTATACTGATGATGTTATGAGGGCTA 60.148 40.741 0.00 0.00 0.00 3.93
2480 2599 4.717279 TCCCTTTTTGTGCTACCTAGTT 57.283 40.909 0.00 0.00 0.00 2.24
2801 2920 0.592247 CGGCCGCTGATTGCATTTAC 60.592 55.000 14.67 0.00 43.06 2.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 135 4.120589 CGATCTCATCCGGATATAGACGA 58.879 47.826 23.94 13.47 0.00 4.20
145 147 1.917872 AGTAGGAGGCGATCTCATCC 58.082 55.000 8.34 8.34 44.19 3.51
592 658 7.323049 CTATCTAGCATAGCCTTGTACGTAT 57.677 40.000 0.00 0.00 38.99 3.06
777 850 3.924507 GCCGACCTTCAATGGCAT 58.075 55.556 0.00 0.00 46.76 4.40
790 863 3.120165 CGAGAAATAGATCGATCAGCCGA 60.120 47.826 26.47 7.23 41.40 5.54
820 893 7.786030 AGACTACAATTAGATGCTGAGCTAAA 58.214 34.615 5.83 0.00 33.85 1.85
1159 1239 7.599171 TCTACAATAGACTTGACGACATTCAA 58.401 34.615 0.00 0.00 34.30 2.69
1305 1385 8.383318 ACGAACCTTCATGAATTTCATATAGG 57.617 34.615 24.04 24.04 40.05 2.57
1745 1852 6.603224 TGCCTCTTTTACCCTTAGTTTTGTA 58.397 36.000 0.00 0.00 0.00 2.41
1794 1901 4.155644 GCATTTCTTCTTCCCTCACAGAAG 59.844 45.833 3.00 3.00 45.15 2.85
2480 2599 1.032114 TCTCTCAATGAGCGGCGAGA 61.032 55.000 12.98 0.77 42.38 4.04


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.