Multiple sequence alignment - TraesCS5D01G120000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G120000 chr5D 100.000 2111 0 0 1 2111 167071682 167073792 0.000000e+00 3899
1 TraesCS5D01G120000 chr5D 95.882 2137 59 15 1 2111 503287048 503289181 0.000000e+00 3432
2 TraesCS5D01G120000 chr5D 95.794 2116 60 16 1 2098 6181198 6179094 0.000000e+00 3387
3 TraesCS5D01G120000 chr5D 95.650 2115 61 20 1 2098 120799620 120801720 0.000000e+00 3367
4 TraesCS5D01G120000 chr5D 96.081 1531 38 13 505 2014 512409297 512407768 0.000000e+00 2475
5 TraesCS5D01G120000 chr5D 96.271 1448 32 12 505 1931 512416234 512414788 0.000000e+00 2355
6 TraesCS5D01G120000 chr6D 96.192 2127 59 17 1 2111 45511823 45509703 0.000000e+00 3459
7 TraesCS5D01G120000 chr1D 96.147 2128 51 18 1 2111 254416813 254418926 0.000000e+00 3446
8 TraesCS5D01G120000 chr1D 95.863 2127 68 16 1 2111 51878325 51876203 0.000000e+00 3422
9 TraesCS5D01G120000 chr1D 94.280 1556 77 12 1 1549 260891855 260893405 0.000000e+00 2370
10 TraesCS5D01G120000 chr1A 95.597 2135 58 20 1 2111 554458215 554460337 0.000000e+00 3389
11 TraesCS5D01G120000 chr4A 94.126 2111 90 19 2 2098 309507385 309505295 0.000000e+00 3181
12 TraesCS5D01G120000 chr2D 95.806 1979 50 16 153 2111 9785044 9787009 0.000000e+00 3164
13 TraesCS5D01G120000 chr2B 94.656 262 11 1 1852 2110 740132057 740132318 9.070000e-109 403
14 TraesCS5D01G120000 chr5A 93.033 244 10 3 1875 2111 657429836 657430079 1.200000e-92 350
15 TraesCS5D01G120000 chr5A 85.294 272 27 5 1801 2063 407122965 407123232 3.450000e-68 268
16 TraesCS5D01G120000 chr3A 93.785 177 8 2 1938 2111 593319680 593319856 1.610000e-66 263


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G120000 chr5D 167071682 167073792 2110 False 3899 3899 100.000 1 2111 1 chr5D.!!$F2 2110
1 TraesCS5D01G120000 chr5D 503287048 503289181 2133 False 3432 3432 95.882 1 2111 1 chr5D.!!$F3 2110
2 TraesCS5D01G120000 chr5D 6179094 6181198 2104 True 3387 3387 95.794 1 2098 1 chr5D.!!$R1 2097
3 TraesCS5D01G120000 chr5D 120799620 120801720 2100 False 3367 3367 95.650 1 2098 1 chr5D.!!$F1 2097
4 TraesCS5D01G120000 chr5D 512407768 512409297 1529 True 2475 2475 96.081 505 2014 1 chr5D.!!$R2 1509
5 TraesCS5D01G120000 chr5D 512414788 512416234 1446 True 2355 2355 96.271 505 1931 1 chr5D.!!$R3 1426
6 TraesCS5D01G120000 chr6D 45509703 45511823 2120 True 3459 3459 96.192 1 2111 1 chr6D.!!$R1 2110
7 TraesCS5D01G120000 chr1D 254416813 254418926 2113 False 3446 3446 96.147 1 2111 1 chr1D.!!$F1 2110
8 TraesCS5D01G120000 chr1D 51876203 51878325 2122 True 3422 3422 95.863 1 2111 1 chr1D.!!$R1 2110
9 TraesCS5D01G120000 chr1D 260891855 260893405 1550 False 2370 2370 94.280 1 1549 1 chr1D.!!$F2 1548
10 TraesCS5D01G120000 chr1A 554458215 554460337 2122 False 3389 3389 95.597 1 2111 1 chr1A.!!$F1 2110
11 TraesCS5D01G120000 chr4A 309505295 309507385 2090 True 3181 3181 94.126 2 2098 1 chr4A.!!$R1 2096
12 TraesCS5D01G120000 chr2D 9785044 9787009 1965 False 3164 3164 95.806 153 2111 1 chr2D.!!$F1 1958

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
794 799 1.201429 CCCCTGCACCTAGGTTGAGT 61.201 60.0 13.15 0.0 36.02 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1682 1719 4.973168 AGCGGATAGAGGCATCATTAAAA 58.027 39.13 0.0 0.0 0.0 1.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
139 140 9.950680 ATTCGTCAATACCATTTCAATTACATC 57.049 29.630 0.00 0.00 0.00 3.06
285 287 4.864806 TCTCATTTGAGAGTGCGAATACAC 59.135 41.667 6.17 0.00 45.48 2.90
417 419 5.014808 AGAATGAAATGCTTGTTATGCCC 57.985 39.130 0.00 0.00 0.00 5.36
748 753 4.156455 ACATTGAATGGGTAGCTACAGG 57.844 45.455 24.75 7.18 33.60 4.00
753 758 5.546621 TGAATGGGTAGCTACAGGAATAC 57.453 43.478 24.75 5.90 0.00 1.89
762 767 7.256547 GGGTAGCTACAGGAATACATTTGGATA 60.257 40.741 24.75 0.00 0.00 2.59
794 799 1.201429 CCCCTGCACCTAGGTTGAGT 61.201 60.000 13.15 0.00 36.02 3.41
1104 1117 2.183300 CGGAATCCTGGACGCGAA 59.817 61.111 15.93 0.00 0.00 4.70
1631 1668 7.582667 TCAAGAAAGGAAAAAGGGTTCTTAG 57.417 36.000 0.00 0.00 36.62 2.18
1682 1719 6.893005 AGCATAAAGTAAGTAGACCTGACTCT 59.107 38.462 0.00 0.00 33.29 3.24
1884 1925 9.553064 TTTGCACTACACATAAAATTGGATTTT 57.447 25.926 4.32 4.32 44.13 1.82
1946 1999 1.072965 CCCATGTAGAGAGGGAATGGC 59.927 57.143 0.00 0.00 45.80 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
139 140 5.890419 AGCAAGAGAATATCCCTCCTTTTTG 59.110 40.000 0.00 0.0 0.00 2.44
285 287 3.150767 TCCCAAACACAAAATACCTCCG 58.849 45.455 0.00 0.0 0.00 4.63
578 581 6.428159 AGATTTCATCGAAAACTTACAGCAGT 59.572 34.615 0.00 0.0 32.20 4.40
748 753 9.343539 AGTAGAAAGGCTTATCCAAATGTATTC 57.656 33.333 0.00 0.0 37.29 1.75
753 758 5.532779 GGGAGTAGAAAGGCTTATCCAAATG 59.467 44.000 0.00 0.0 37.29 2.32
762 767 0.621082 GCAGGGGAGTAGAAAGGCTT 59.379 55.000 0.00 0.0 0.00 4.35
816 821 8.874743 AAATAGGGTTAGGTGGTTAGGTATTA 57.125 34.615 0.00 0.0 0.00 0.98
941 951 2.292292 CAGTTTTTCCTTACCACACGGG 59.708 50.000 0.00 0.0 44.81 5.28
1157 1176 0.618458 TCTGACCCCCGGATTTTCTG 59.382 55.000 0.73 0.0 0.00 3.02
1478 1506 5.869888 GTCTCTCGGCCAATATCGATTTTAT 59.130 40.000 1.71 0.0 34.77 1.40
1520 1553 4.764823 CCTATATGGAAATGCCCGCTAAAA 59.235 41.667 0.00 0.0 38.35 1.52
1616 1653 5.926542 GTGGATTTGCTAAGAACCCTTTTTC 59.073 40.000 0.00 0.0 33.94 2.29
1631 1668 6.878389 TCTTTCCAATTTTATGGTGGATTTGC 59.122 34.615 0.00 0.0 41.05 3.68
1682 1719 4.973168 AGCGGATAGAGGCATCATTAAAA 58.027 39.130 0.00 0.0 0.00 1.52
1863 1904 9.927668 CCTTCAAAATCCAATTTTATGTGTAGT 57.072 29.630 0.00 0.0 40.27 2.73
1975 2028 8.595362 ATTTCAAAGTCTATCTTTTAAGGGGG 57.405 34.615 0.00 0.0 42.95 5.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.