Multiple sequence alignment - TraesCS5D01G119900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G119900 chr5D 100.000 2187 0 0 1 2187 167071094 167073280 0 4039
1 TraesCS5D01G119900 chr5D 96.278 2203 62 11 1 2187 503286461 503288659 0 3596
2 TraesCS5D01G119900 chr5D 96.266 2196 66 15 1 2187 120799031 120801219 0 3587
3 TraesCS5D01G119900 chr5D 96.042 2198 62 16 1 2187 6181783 6179600 0 3554
4 TraesCS5D01G119900 chr5D 96.480 1108 25 9 1093 2187 512409297 512408191 0 1818
5 TraesCS5D01G119900 chr5D 96.396 1110 24 10 1093 2187 512416234 512415126 0 1814
6 TraesCS5D01G119900 chr1D 96.313 2197 57 15 1 2187 254416225 254418407 0 3587
7 TraesCS5D01G119900 chr1D 95.947 2196 74 13 1 2187 51878911 51876722 0 3548
8 TraesCS5D01G119900 chr1D 94.403 2144 107 13 1 2137 260891268 260893405 0 3282
9 TraesCS5D01G119900 chr6D 96.347 2190 59 15 1 2181 45512403 45510226 0 3581
10 TraesCS5D01G119900 chr4A 94.591 1738 82 9 1 1737 310731433 310729707 0 2678
11 TraesCS5D01G119900 chr2A 96.326 1633 54 5 1 1633 335831467 335829841 0 2678


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G119900 chr5D 167071094 167073280 2186 False 4039 4039 100.000 1 2187 1 chr5D.!!$F2 2186
1 TraesCS5D01G119900 chr5D 503286461 503288659 2198 False 3596 3596 96.278 1 2187 1 chr5D.!!$F3 2186
2 TraesCS5D01G119900 chr5D 120799031 120801219 2188 False 3587 3587 96.266 1 2187 1 chr5D.!!$F1 2186
3 TraesCS5D01G119900 chr5D 6179600 6181783 2183 True 3554 3554 96.042 1 2187 1 chr5D.!!$R1 2186
4 TraesCS5D01G119900 chr5D 512408191 512409297 1106 True 1818 1818 96.480 1093 2187 1 chr5D.!!$R2 1094
5 TraesCS5D01G119900 chr5D 512415126 512416234 1108 True 1814 1814 96.396 1093 2187 1 chr5D.!!$R3 1094
6 TraesCS5D01G119900 chr1D 254416225 254418407 2182 False 3587 3587 96.313 1 2187 1 chr1D.!!$F1 2186
7 TraesCS5D01G119900 chr1D 51876722 51878911 2189 True 3548 3548 95.947 1 2187 1 chr1D.!!$R1 2186
8 TraesCS5D01G119900 chr1D 260891268 260893405 2137 False 3282 3282 94.403 1 2137 1 chr1D.!!$F2 2136
9 TraesCS5D01G119900 chr6D 45510226 45512403 2177 True 3581 3581 96.347 1 2181 1 chr6D.!!$R1 2180
10 TraesCS5D01G119900 chr4A 310729707 310731433 1726 True 2678 2678 94.591 1 1737 1 chr4A.!!$R1 1736
11 TraesCS5D01G119900 chr2A 335829841 335831467 1626 True 2678 2678 96.326 1 1633 1 chr2A.!!$R1 1632

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
430 434 4.454678 TGAATGTGCTTGATAGATCCCAC 58.545 43.478 0.0 0.0 0.0 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1745 1763 0.618458 TCTGACCCCCGGATTTTCTG 59.382 55.0 0.73 0.0 0.0 3.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 8.856490 AAACATGACTAAACAAGTTTGCTTAG 57.144 30.769 8.37 11.51 39.21 2.18
118 119 7.797121 ATTCTTAAATTTCCACCCTCAACAT 57.203 32.000 0.00 0.00 0.00 2.71
367 370 5.860611 TCAACTCGAATACCAAAAGGAAGA 58.139 37.500 0.00 0.00 0.00 2.87
430 434 4.454678 TGAATGTGCTTGATAGATCCCAC 58.545 43.478 0.00 0.00 0.00 4.61
450 454 9.710900 ATCCCACTTTTTCATGAAAATAAAGAC 57.289 29.630 29.13 0.00 39.69 3.01
452 456 9.323985 CCCACTTTTTCATGAAAATAAAGACAA 57.676 29.630 29.13 14.03 39.69 3.18
475 479 7.040409 ACAATCAATTTGACTGGACTTAAGACC 60.040 37.037 15.99 15.99 38.76 3.85
727 731 9.950680 ATTCGTCAATACCATTTCAATTACATC 57.049 29.630 0.00 0.00 0.00 3.06
873 878 4.864806 TCTCATTTGAGAGTGCGAATACAC 59.135 41.667 6.17 0.00 45.48 2.90
1005 1011 5.014808 AGAATGAAATGCTTGTTATGCCC 57.985 39.130 0.00 0.00 0.00 5.36
1336 1345 4.156455 ACATTGAATGGGTAGCTACAGG 57.844 45.455 24.75 7.18 33.60 4.00
1341 1350 5.546621 TGAATGGGTAGCTACAGGAATAC 57.453 43.478 24.75 5.90 0.00 1.89
1350 1359 7.256547 GGGTAGCTACAGGAATACATTTGGATA 60.257 40.741 24.75 0.00 0.00 2.59
1382 1391 1.201429 CCCCTGCACCTAGGTTGAGT 61.201 60.000 13.15 0.00 36.02 3.41
1692 1706 2.183300 CGGAATCCTGGACGCGAA 59.817 61.111 15.93 0.00 0.00 4.70
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
62 63 8.345565 AGTTCTAAGCAAACTTGTTTAGTCATG 58.654 33.333 19.30 0.00 45.97 3.07
118 119 5.244626 TCAAGATTGATCATCTCGAGCCATA 59.755 40.000 7.81 0.00 41.93 2.74
450 454 7.175641 AGGTCTTAAGTCCAGTCAAATTGATTG 59.824 37.037 19.10 10.97 40.58 2.67
452 456 6.784031 AGGTCTTAAGTCCAGTCAAATTGAT 58.216 36.000 19.10 0.00 0.00 2.57
535 539 8.862085 TGGTGAAATCATATAGTATTCCGTACA 58.138 33.333 0.00 0.00 35.67 2.90
572 576 3.055385 CCTTCCGTCCCAGATTGTTTCTA 60.055 47.826 0.00 0.00 31.77 2.10
727 731 5.890419 AGCAAGAGAATATCCCTCCTTTTTG 59.110 40.000 0.00 0.00 0.00 2.44
873 878 3.150767 TCCCAAACACAAAATACCTCCG 58.849 45.455 0.00 0.00 0.00 4.63
1166 1173 6.428159 AGATTTCATCGAAAACTTACAGCAGT 59.572 34.615 0.00 0.00 32.20 4.40
1336 1345 9.343539 AGTAGAAAGGCTTATCCAAATGTATTC 57.656 33.333 0.00 0.00 37.29 1.75
1341 1350 5.532779 GGGAGTAGAAAGGCTTATCCAAATG 59.467 44.000 0.00 0.00 37.29 2.32
1350 1359 0.621082 GCAGGGGAGTAGAAAGGCTT 59.379 55.000 0.00 0.00 0.00 4.35
1404 1413 8.874743 AAATAGGGTTAGGTGGTTAGGTATTA 57.125 34.615 0.00 0.00 0.00 0.98
1529 1541 2.292292 CAGTTTTTCCTTACCACACGGG 59.708 50.000 0.00 0.00 44.81 5.28
1745 1763 0.618458 TCTGACCCCCGGATTTTCTG 59.382 55.000 0.73 0.00 0.00 3.02
2064 2089 7.544566 GTCTCTCGGCCAATATCGATTTTATAA 59.455 37.037 1.71 0.00 34.77 0.98
2066 2091 5.869888 GTCTCTCGGCCAATATCGATTTTAT 59.130 40.000 1.71 0.00 34.77 1.40
2108 2136 4.764823 CCTATATGGAAATGCCCGCTAAAA 59.235 41.667 0.00 0.00 38.35 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.