Multiple sequence alignment - TraesCS5D01G117300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G117300 chr5D 100.000 2387 0 0 1 2387 139926599 139924213 0 4409
1 TraesCS5D01G117300 chr5D 98.202 2391 39 2 1 2387 200110166 200112556 0 4174
2 TraesCS5D01G117300 chr5D 98.200 2389 37 6 1 2387 199041547 199039163 0 4169
3 TraesCS5D01G117300 chr5D 97.826 2392 46 4 1 2387 66683679 66686069 0 4124
4 TraesCS5D01G117300 chrUn 99.037 2389 21 1 1 2387 123089293 123086905 0 4283
5 TraesCS5D01G117300 chrUn 98.912 2389 24 1 1 2387 161184347 161186735 0 4266
6 TraesCS5D01G117300 chr2D 98.660 2388 31 1 1 2387 540728743 540731130 0 4231
7 TraesCS5D01G117300 chr2D 97.826 2392 42 6 1 2387 181510298 181507912 0 4120
8 TraesCS5D01G117300 chr2D 97.822 2387 51 1 1 2387 493667144 493669529 0 4119
9 TraesCS5D01G117300 chr6D 98.160 2391 40 2 1 2387 335631280 335633670 0 4169


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G117300 chr5D 139924213 139926599 2386 True 4409 4409 100.000 1 2387 1 chr5D.!!$R1 2386
1 TraesCS5D01G117300 chr5D 200110166 200112556 2390 False 4174 4174 98.202 1 2387 1 chr5D.!!$F2 2386
2 TraesCS5D01G117300 chr5D 199039163 199041547 2384 True 4169 4169 98.200 1 2387 1 chr5D.!!$R2 2386
3 TraesCS5D01G117300 chr5D 66683679 66686069 2390 False 4124 4124 97.826 1 2387 1 chr5D.!!$F1 2386
4 TraesCS5D01G117300 chrUn 123086905 123089293 2388 True 4283 4283 99.037 1 2387 1 chrUn.!!$R1 2386
5 TraesCS5D01G117300 chrUn 161184347 161186735 2388 False 4266 4266 98.912 1 2387 1 chrUn.!!$F1 2386
6 TraesCS5D01G117300 chr2D 540728743 540731130 2387 False 4231 4231 98.660 1 2387 1 chr2D.!!$F2 2386
7 TraesCS5D01G117300 chr2D 181507912 181510298 2386 True 4120 4120 97.826 1 2387 1 chr2D.!!$R1 2386
8 TraesCS5D01G117300 chr2D 493667144 493669529 2385 False 4119 4119 97.822 1 2387 1 chr2D.!!$F1 2386
9 TraesCS5D01G117300 chr6D 335631280 335633670 2390 False 4169 4169 98.160 1 2387 1 chr6D.!!$F1 2386

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
729 735 1.568025 GCCGTTTGGTCGACACTTC 59.432 57.895 18.91 0.0 37.67 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2014 2029 0.589223 CTTGGCGTAGGTTGCGAAAA 59.411 50.0 0.0 0.0 29.59 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
317 321 4.499357 GCCTTAGGTCGTGGTCTTATACTG 60.499 50.000 0.00 0.0 0.00 2.74
646 652 4.171234 TCTTCTCATTTCTGACCCCTCTT 58.829 43.478 0.00 0.0 0.00 2.85
729 735 1.568025 GCCGTTTGGTCGACACTTC 59.432 57.895 18.91 0.0 37.67 3.01
1154 1160 4.534103 ACTCCAAGAAGAACTCAAGGCTAT 59.466 41.667 0.00 0.0 0.00 2.97
1503 1514 8.983702 TGGATTGATTGAGTGATATTGATTGA 57.016 30.769 0.00 0.0 0.00 2.57
1735 1750 1.072331 CCACCTGTTGACCACTTAGCT 59.928 52.381 0.00 0.0 0.00 3.32
2014 2029 2.988010 TGGCTATGAAGAAGCGTGAT 57.012 45.000 0.00 0.0 41.03 3.06
2314 2329 1.889829 CAAAAGCCACGATTTACCCCA 59.110 47.619 0.00 0.0 0.00 4.96
2338 2353 0.843309 TGGGAGGACAGTTTCAGCAA 59.157 50.000 0.00 0.0 0.00 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
317 321 1.078848 AACTCCAGCGGCATCACTC 60.079 57.895 1.45 0.00 0.00 3.51
646 652 6.879458 GCCATTCCTAAAAGAGTAGAAAGTGA 59.121 38.462 0.00 0.00 0.00 3.41
729 735 4.703897 TCAAGTACTTGGTGACTTCCTTG 58.296 43.478 30.35 5.95 40.78 3.61
1154 1160 2.432874 TCCTCCAAATAATCTTCGCGGA 59.567 45.455 6.13 0.00 0.00 5.54
1503 1514 5.452255 ACCCATATGCTCATGAGACAAATT 58.548 37.500 27.04 10.98 0.00 1.82
1735 1750 3.328505 CGGGTTTAGCCTTAAGAAACGA 58.671 45.455 3.36 0.00 34.55 3.85
2014 2029 0.589223 CTTGGCGTAGGTTGCGAAAA 59.411 50.000 0.00 0.00 29.59 2.29
2314 2329 1.494721 TGAAACTGTCCTCCCAGCTTT 59.505 47.619 0.00 0.00 35.83 3.51
2338 2353 2.197465 GAACTACCTCCTCCATGGGTT 58.803 52.381 13.02 5.12 34.86 4.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.