Multiple sequence alignment - TraesCS5D01G108300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G108300 chr5D 100.000 3068 0 0 1 3068 122071304 122068237 0 5666
1 TraesCS5D01G108300 chr5D 98.396 2057 23 8 1 2047 135673750 135671694 0 3607
2 TraesCS5D01G108300 chr4D 97.823 2067 25 7 1 2047 249077944 249080010 0 3550
3 TraesCS5D01G108300 chr4D 97.680 2069 25 9 1 2047 369863658 369865725 0 3533
4 TraesCS5D01G108300 chr4D 97.155 2074 30 9 1 2047 97425768 97427839 0 3476
5 TraesCS5D01G108300 chr4D 99.220 1025 8 0 2044 3068 369884740 369885764 0 1849
6 TraesCS5D01G108300 chr4D 99.024 1025 10 0 2044 3068 369867883 369868907 0 1838
7 TraesCS5D01G108300 chr4D 98.927 1025 11 0 2044 3068 249082264 249083288 0 1832
8 TraesCS5D01G108300 chr3D 97.679 2068 26 7 1 2047 121308970 121311036 0 3533
9 TraesCS5D01G108300 chr3D 96.940 1830 29 7 245 2047 523176977 523178806 0 3044
10 TraesCS5D01G108300 chr3D 99.220 1025 8 0 2044 3068 121313231 121314255 0 1849
11 TraesCS5D01G108300 chr3D 99.122 1025 9 0 2044 3068 523891574 523890550 0 1844
12 TraesCS5D01G108300 chr2D 97.679 2068 26 7 1 2047 615578821 615580887 0 3533
13 TraesCS5D01G108300 chr2D 97.778 900 11 4 1 891 78404126 78403227 0 1543
14 TraesCS5D01G108300 chr2D 95.646 689 10 5 1 669 643707926 643708614 0 1088
15 TraesCS5D01G108300 chr6D 97.734 1986 24 8 81 2047 93260156 93258173 0 3398
16 TraesCS5D01G108300 chr6D 97.101 2001 23 8 79 2047 286469787 286467790 0 3341
17 TraesCS5D01G108300 chr6D 99.220 1025 8 0 2044 3068 93255985 93254961 0 1849
18 TraesCS5D01G108300 chr7D 99.024 1025 10 0 2044 3068 10522203 10523227 0 1838
19 TraesCS5D01G108300 chr7D 98.927 1025 11 0 2044 3068 116422176 116423200 0 1832
20 TraesCS5D01G108300 chr7D 98.927 1025 11 0 2044 3068 523259506 523258482 0 1832
21 TraesCS5D01G108300 chr7D 95.556 585 7 6 1 566 178479655 178480239 0 918
22 TraesCS5D01G108300 chr7D 95.214 585 9 5 1 566 175881388 175880804 0 907


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G108300 chr5D 122068237 122071304 3067 True 5666.0 5666 100.0000 1 3068 1 chr5D.!!$R1 3067
1 TraesCS5D01G108300 chr5D 135671694 135673750 2056 True 3607.0 3607 98.3960 1 2047 1 chr5D.!!$R2 2046
2 TraesCS5D01G108300 chr4D 97425768 97427839 2071 False 3476.0 3476 97.1550 1 2047 1 chr4D.!!$F1 2046
3 TraesCS5D01G108300 chr4D 249077944 249083288 5344 False 2691.0 3550 98.3750 1 3068 2 chr4D.!!$F3 3067
4 TraesCS5D01G108300 chr4D 369863658 369868907 5249 False 2685.5 3533 98.3520 1 3068 2 chr4D.!!$F4 3067
5 TraesCS5D01G108300 chr4D 369884740 369885764 1024 False 1849.0 1849 99.2200 2044 3068 1 chr4D.!!$F2 1024
6 TraesCS5D01G108300 chr3D 523176977 523178806 1829 False 3044.0 3044 96.9400 245 2047 1 chr3D.!!$F1 1802
7 TraesCS5D01G108300 chr3D 121308970 121314255 5285 False 2691.0 3533 98.4495 1 3068 2 chr3D.!!$F2 3067
8 TraesCS5D01G108300 chr3D 523890550 523891574 1024 True 1844.0 1844 99.1220 2044 3068 1 chr3D.!!$R1 1024
9 TraesCS5D01G108300 chr2D 615578821 615580887 2066 False 3533.0 3533 97.6790 1 2047 1 chr2D.!!$F1 2046
10 TraesCS5D01G108300 chr2D 78403227 78404126 899 True 1543.0 1543 97.7780 1 891 1 chr2D.!!$R1 890
11 TraesCS5D01G108300 chr2D 643707926 643708614 688 False 1088.0 1088 95.6460 1 669 1 chr2D.!!$F2 668
12 TraesCS5D01G108300 chr6D 286467790 286469787 1997 True 3341.0 3341 97.1010 79 2047 1 chr6D.!!$R1 1968
13 TraesCS5D01G108300 chr6D 93254961 93260156 5195 True 2623.5 3398 98.4770 81 3068 2 chr6D.!!$R2 2987
14 TraesCS5D01G108300 chr7D 10522203 10523227 1024 False 1838.0 1838 99.0240 2044 3068 1 chr7D.!!$F1 1024
15 TraesCS5D01G108300 chr7D 116422176 116423200 1024 False 1832.0 1832 98.9270 2044 3068 1 chr7D.!!$F2 1024
16 TraesCS5D01G108300 chr7D 523258482 523259506 1024 True 1832.0 1832 98.9270 2044 3068 1 chr7D.!!$R2 1024
17 TraesCS5D01G108300 chr7D 178479655 178480239 584 False 918.0 918 95.5560 1 566 1 chr7D.!!$F3 565
18 TraesCS5D01G108300 chr7D 175880804 175881388 584 True 907.0 907 95.2140 1 566 1 chr7D.!!$R1 565

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
703 756 1.590932 TTTAAACGCCCACGCTGTAA 58.409 45.0 0.00 0.0 45.53 2.41 F
1348 1405 0.036952 CGTGAAGGAGGTCACTGCAT 60.037 55.0 4.03 0.0 44.79 3.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1527 1585 1.676678 GCCCATCTACCTCGTCAGCA 61.677 60.0 0.0 0.0 0.00 4.41 R
2959 5309 0.551131 AGAGGGCATCCAAGAAGGGT 60.551 55.0 0.0 0.0 38.24 4.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 132 4.725556 AATATTATTCGTTCGCACGCAT 57.274 36.364 1.72 0.0 46.70 4.73
213 215 9.332502 TGTGTGAATTGTATTAGTTGTTAGTGT 57.667 29.630 0.00 0.0 0.00 3.55
703 756 1.590932 TTTAAACGCCCACGCTGTAA 58.409 45.000 0.00 0.0 45.53 2.41
1043 1100 7.931015 TGAGATTTTACTATGGTCCTGGTAT 57.069 36.000 0.00 0.0 0.00 2.73
1168 1225 2.843401 TGCGGCAAGTTTAGGTCTTA 57.157 45.000 0.00 0.0 0.00 2.10
1188 1245 6.018507 GTCTTAATACTGAAACACACACCGTT 60.019 38.462 0.00 0.0 0.00 4.44
1348 1405 0.036952 CGTGAAGGAGGTCACTGCAT 60.037 55.000 4.03 0.0 44.79 3.96
1389 1446 2.611473 CGAAGGACAGAGCAGTCATGTT 60.611 50.000 6.35 0.0 40.29 2.71
1527 1585 2.172505 TGATTACAATGGCGAGGTGGAT 59.827 45.455 0.00 0.0 0.00 3.41
1936 1995 6.485313 CACAAGTTGGGTGATAAGTGACTTAA 59.515 38.462 9.35 0.0 38.54 1.85
2175 4525 3.708631 CTGGAAGATACACTCAGGATGGT 59.291 47.826 0.00 0.0 34.07 3.55
2959 5309 3.002791 CAGCTTACATCGAGAAAGCCAA 58.997 45.455 19.65 0.0 45.32 4.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 132 5.599359 TTATTTTCACATCGAACGAAGCA 57.401 34.783 0.12 0.00 31.73 3.91
716 769 8.110860 TGTAAAATTCTTCCTTGCTAAGAAGG 57.889 34.615 6.66 0.81 43.98 3.46
1043 1100 4.026744 TCCCAACTCATTTGTTTGGACAA 58.973 39.130 12.45 0.00 43.73 3.18
1168 1225 3.314080 CCAACGGTGTGTGTTTCAGTATT 59.686 43.478 0.00 0.00 0.00 1.89
1188 1245 1.612950 GTCCACAATGCATGAACACCA 59.387 47.619 0.00 0.00 0.00 4.17
1348 1405 0.645496 TAGCCACCCTCCCCTTCATA 59.355 55.000 0.00 0.00 0.00 2.15
1389 1446 4.591321 ACCATAAGCATTTCCTCCTTCA 57.409 40.909 0.00 0.00 0.00 3.02
1527 1585 1.676678 GCCCATCTACCTCGTCAGCA 61.677 60.000 0.00 0.00 0.00 4.41
1936 1995 7.067494 GCAGGGAATAAGACAAGTGTGATTAAT 59.933 37.037 0.00 0.00 0.00 1.40
2175 4525 2.151881 TAAAGCACGTACCGCTGAAA 57.848 45.000 5.27 0.00 40.35 2.69
2959 5309 0.551131 AGAGGGCATCCAAGAAGGGT 60.551 55.000 0.00 0.00 38.24 4.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.