Multiple sequence alignment - TraesCS5D01G107100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G107100 chr5D 100.000 2111 0 0 1 2111 120799615 120801725 0 3899
1 TraesCS5D01G107100 chr5D 97.226 2127 37 14 1 2106 503287043 503289168 0 3581
2 TraesCS5D01G107100 chr5D 96.570 2128 43 16 1 2111 6181203 6179089 0 3498
3 TraesCS5D01G107100 chr5D 95.660 2120 61 20 1 2106 167071677 167073779 0 3376
4 TraesCS5D01G107100 chr5D 97.389 1532 22 10 507 2022 512409297 512407768 0 2591
5 TraesCS5D01G107100 chr5D 97.376 1448 19 10 507 1936 512416234 512414788 0 2446
6 TraesCS5D01G107100 chr1D 97.121 2119 35 12 1 2106 254416808 254418913 0 3552
7 TraesCS5D01G107100 chr1D 96.840 2120 48 12 1 2106 51878330 51876216 0 3526
8 TraesCS5D01G107100 chr1D 95.577 1560 60 9 1 1555 260891850 260893405 0 2490
9 TraesCS5D01G107100 chr6D 97.033 2123 36 17 1 2106 45511828 45509716 0 3546
10 TraesCS5D01G107100 chr1A 96.432 2130 37 20 1 2106 554458210 554460324 0 3476
11 TraesCS5D01G107100 chr4A 94.915 2124 73 16 1 2111 309507391 309505290 0 3291
12 TraesCS5D01G107100 chr4A 96.101 1154 38 7 1 1151 310730856 310729707 0 1875
13 TraesCS5D01G107100 chr2D 96.797 1967 32 15 157 2106 9785044 9786996 0 3254
14 TraesCS5D01G107100 chr7B 94.256 2124 86 20 1 2111 105256852 105254752 0 3214
15 TraesCS5D01G107100 chr7D 97.101 690 9 8 1428 2106 77239997 77240686 0 1153


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G107100 chr5D 120799615 120801725 2110 False 3899 3899 100.000 1 2111 1 chr5D.!!$F1 2110
1 TraesCS5D01G107100 chr5D 503287043 503289168 2125 False 3581 3581 97.226 1 2106 1 chr5D.!!$F3 2105
2 TraesCS5D01G107100 chr5D 6179089 6181203 2114 True 3498 3498 96.570 1 2111 1 chr5D.!!$R1 2110
3 TraesCS5D01G107100 chr5D 167071677 167073779 2102 False 3376 3376 95.660 1 2106 1 chr5D.!!$F2 2105
4 TraesCS5D01G107100 chr5D 512407768 512409297 1529 True 2591 2591 97.389 507 2022 1 chr5D.!!$R2 1515
5 TraesCS5D01G107100 chr5D 512414788 512416234 1446 True 2446 2446 97.376 507 1936 1 chr5D.!!$R3 1429
6 TraesCS5D01G107100 chr1D 254416808 254418913 2105 False 3552 3552 97.121 1 2106 1 chr1D.!!$F1 2105
7 TraesCS5D01G107100 chr1D 51876216 51878330 2114 True 3526 3526 96.840 1 2106 1 chr1D.!!$R1 2105
8 TraesCS5D01G107100 chr1D 260891850 260893405 1555 False 2490 2490 95.577 1 1555 1 chr1D.!!$F2 1554
9 TraesCS5D01G107100 chr6D 45509716 45511828 2112 True 3546 3546 97.033 1 2106 1 chr6D.!!$R1 2105
10 TraesCS5D01G107100 chr1A 554458210 554460324 2114 False 3476 3476 96.432 1 2106 1 chr1A.!!$F1 2105
11 TraesCS5D01G107100 chr4A 309505290 309507391 2101 True 3291 3291 94.915 1 2111 1 chr4A.!!$R1 2110
12 TraesCS5D01G107100 chr4A 310729707 310730856 1149 True 1875 1875 96.101 1 1151 1 chr4A.!!$R2 1150
13 TraesCS5D01G107100 chr2D 9785044 9786996 1952 False 3254 3254 96.797 157 2106 1 chr2D.!!$F1 1949
14 TraesCS5D01G107100 chr7B 105254752 105256852 2100 True 3214 3214 94.256 1 2111 1 chr7B.!!$R1 2110
15 TraesCS5D01G107100 chr7D 77239997 77240686 689 False 1153 1153 97.101 1428 2106 1 chr7D.!!$F1 678

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
468 472 8.754991 TCTGTTTTAATTCTGTTCTTTACCCA 57.245 30.769 0.0 0.0 0.0 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1359 1393 0.106116 AGGGGGTTTTTGCAACCGTA 60.106 50.0 0.0 0.0 41.18 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
468 472 8.754991 TCTGTTTTAATTCTGTTCTTTACCCA 57.245 30.769 0.00 0.0 0.00 4.51
1025 1054 8.634475 ATGCTTACTCTCAAACTTTTTGTTTC 57.366 30.769 0.00 0.0 46.11 2.78
1122 1155 7.148590 GGACGCGAGGAGTAAAAATTTAGTTTA 60.149 37.037 15.93 0.0 0.00 2.01
1123 1156 8.260270 ACGCGAGGAGTAAAAATTTAGTTTAT 57.740 30.769 15.93 0.0 0.00 1.40
1249 1283 1.202382 GGATTCGAACCCTCGGTACAG 60.202 57.143 0.00 0.0 45.49 2.74
1295 1329 0.669318 CGCCGCTTTAGTCCACTCAA 60.669 55.000 0.00 0.0 0.00 3.02
1377 1414 0.751452 TTACGGTTGCAAAAACCCCC 59.249 50.000 0.00 0.0 36.99 5.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
331 334 5.163405 GGGAAAGAAGGAAAAGGCATATTCC 60.163 44.000 7.62 7.62 44.45 3.01
1123 1156 9.932699 TGTACGAAACAAATCGAATAAGAAAAA 57.067 25.926 3.47 0.00 45.48 1.94
1249 1283 7.861176 TTGCTAATCCGTTGTACAATTTTTC 57.139 32.000 12.26 0.00 0.00 2.29
1295 1329 1.348064 TTGGAACGTGGAGAGATGGT 58.652 50.000 0.00 0.00 0.00 3.55
1359 1393 0.106116 AGGGGGTTTTTGCAACCGTA 60.106 50.000 0.00 0.00 41.18 4.02
1614 1661 7.791029 TGATAAGAACCCTTTTTGCTTTCTTT 58.209 30.769 0.00 0.00 37.60 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.