Multiple sequence alignment - TraesCS5D01G107000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G107000 chr5D 100.000 2182 0 0 1 2182 120799030 120801211 0 4030
1 TraesCS5D01G107000 chr5D 97.806 2188 34 13 1 2177 503286460 503288644 0 3762
2 TraesCS5D01G107000 chr5D 97.170 2191 38 17 1 2182 6181784 6179609 0 3681
3 TraesCS5D01G107000 chr5D 96.298 2188 66 14 1 2182 167071093 167073271 0 3578
4 TraesCS5D01G107000 chr5D 98.087 1098 14 6 1092 2182 512409297 512408200 0 1905
5 TraesCS5D01G107000 chr1D 97.714 2187 34 7 1 2182 254416224 254418399 0 3747
6 TraesCS5D01G107000 chr1D 97.122 2189 50 11 1 2182 51878912 51876730 0 3681
7 TraesCS5D01G107000 chr1D 95.711 2145 81 11 1 2140 260891267 260893405 0 3441
8 TraesCS5D01G107000 chr6D 97.398 2191 33 14 1 2182 45512404 45510229 0 3709
9 TraesCS5D01G107000 chr4A 96.034 1740 53 13 1 1736 310731434 310729707 0 2817
10 TraesCS5D01G107000 chr2A 97.548 1631 36 4 1 1630 335831468 335829841 0 2787
11 TraesCS5D01G107000 chr2A 96.627 1186 24 6 1003 2182 334595896 334594721 0 1954


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G107000 chr5D 120799030 120801211 2181 False 4030 4030 100.000 1 2182 1 chr5D.!!$F1 2181
1 TraesCS5D01G107000 chr5D 503286460 503288644 2184 False 3762 3762 97.806 1 2177 1 chr5D.!!$F3 2176
2 TraesCS5D01G107000 chr5D 6179609 6181784 2175 True 3681 3681 97.170 1 2182 1 chr5D.!!$R1 2181
3 TraesCS5D01G107000 chr5D 167071093 167073271 2178 False 3578 3578 96.298 1 2182 1 chr5D.!!$F2 2181
4 TraesCS5D01G107000 chr5D 512408200 512409297 1097 True 1905 1905 98.087 1092 2182 1 chr5D.!!$R2 1090
5 TraesCS5D01G107000 chr1D 254416224 254418399 2175 False 3747 3747 97.714 1 2182 1 chr1D.!!$F1 2181
6 TraesCS5D01G107000 chr1D 51876730 51878912 2182 True 3681 3681 97.122 1 2182 1 chr1D.!!$R1 2181
7 TraesCS5D01G107000 chr1D 260891267 260893405 2138 False 3441 3441 95.711 1 2140 1 chr1D.!!$F2 2139
8 TraesCS5D01G107000 chr6D 45510229 45512404 2175 True 3709 3709 97.398 1 2182 1 chr6D.!!$R1 2181
9 TraesCS5D01G107000 chr4A 310729707 310731434 1727 True 2817 2817 96.034 1 1736 1 chr4A.!!$R1 1735
10 TraesCS5D01G107000 chr2A 335829841 335831468 1627 True 2787 2787 97.548 1 1630 1 chr2A.!!$R2 1629
11 TraesCS5D01G107000 chr2A 334594721 334595896 1175 True 1954 1954 96.627 1003 2182 1 chr2A.!!$R1 1179

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
136 137 0.887247 CGGATGGCTCGAGATGATCT 59.113 55.0 18.75 0.0 0.0 2.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1944 1967 0.106116 AGGGGGTTTTTGCAACCGTA 60.106 50.0 0.0 0.0 41.18 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
136 137 0.887247 CGGATGGCTCGAGATGATCT 59.113 55.000 18.75 0.00 0.00 2.75
544 547 2.742954 AAACTTTTGTGTCGTACGGC 57.257 45.000 14.12 14.12 0.00 5.68
1053 1060 8.754991 TCTGTTTTAATTCTGTTCTTTACCCA 57.245 30.769 0.00 0.00 0.00 4.51
1264 1278 4.563140 ATGGGTAAAAGCCGAGAAGTTA 57.437 40.909 0.00 0.00 38.98 2.24
1610 1629 8.634475 ATGCTTACTCTCAAACTTTTTGTTTC 57.366 30.769 0.00 0.00 46.11 2.78
1707 1729 7.148590 GGACGCGAGGAGTAAAAATTTAGTTTA 60.149 37.037 15.93 0.00 0.00 2.01
1708 1730 8.260270 ACGCGAGGAGTAAAAATTTAGTTTAT 57.740 30.769 15.93 0.00 0.00 1.40
1834 1857 1.202382 GGATTCGAACCCTCGGTACAG 60.202 57.143 0.00 0.00 45.49 2.74
1880 1903 0.669318 CGCCGCTTTAGTCCACTCAA 60.669 55.000 0.00 0.00 0.00 3.02
1962 1987 0.751452 TTACGGTTGCAAAAACCCCC 59.249 50.000 0.00 0.00 36.99 5.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
136 137 7.969690 ATCCTTCTCTTCTCACTTCAAGATA 57.030 36.000 0.00 0.00 0.00 1.98
535 538 7.008086 GTGAAATCATATAGTATGCCGTACGAC 59.992 40.741 18.76 5.50 38.38 4.34
916 922 5.163405 GGGAAAGAAGGAAAAGGCATATTCC 60.163 44.000 7.62 7.62 44.45 3.01
1708 1730 9.932699 TGTACGAAACAAATCGAATAAGAAAAA 57.067 25.926 3.47 0.00 45.48 1.94
1834 1857 7.861176 TTGCTAATCCGTTGTACAATTTTTC 57.139 32.000 12.26 0.00 0.00 2.29
1880 1903 1.348064 TTGGAACGTGGAGAGATGGT 58.652 50.000 0.00 0.00 0.00 3.55
1944 1967 0.106116 AGGGGGTTTTTGCAACCGTA 60.106 50.000 0.00 0.00 41.18 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.