Multiple sequence alignment - TraesCS5D01G082500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G082500 chr5D 100.000 2192 0 0 1 2192 84381209 84379018 0 4048
1 TraesCS5D01G082500 chr3D 96.989 1561 23 3 1 1558 80219319 80217780 0 2601
2 TraesCS5D01G082500 chr2D 96.073 1579 36 10 1 1555 30082018 30080442 0 2549
3 TraesCS5D01G082500 chr2D 96.085 1558 36 4 1 1555 30186810 30185275 0 2516
4 TraesCS5D01G082500 chr2D 97.383 879 17 2 1 879 30143693 30142821 0 1491
5 TraesCS5D01G082500 chr4D 94.949 1564 68 6 3 1558 467823104 467821544 0 2440
6 TraesCS5D01G082500 chr1A 94.309 1564 44 10 1 1558 7646344 7647868 0 2353
7 TraesCS5D01G082500 chrUn 93.679 1582 48 15 4 1555 332493324 332491765 0 2320
8 TraesCS5D01G082500 chrUn 86.711 1505 157 25 1 1480 111010659 111012145 0 1631
9 TraesCS5D01G082500 chrUn 96.570 758 21 2 803 1555 370576071 370576828 0 1251
10 TraesCS5D01G082500 chr3A 93.252 1482 63 10 1 1478 572551623 572550175 0 2148
11 TraesCS5D01G082500 chr2B 90.961 1582 92 12 1 1558 57915033 57916587 0 2082
12 TraesCS5D01G082500 chr2B 89.339 1604 80 16 1 1558 54461307 54459749 0 1930
13 TraesCS5D01G082500 chr7A 91.026 1560 69 25 1 1556 282556261 282557753 0 2039
14 TraesCS5D01G082500 chr7A 91.779 1484 68 23 1 1456 90656404 90657861 0 2015
15 TraesCS5D01G082500 chr2A 91.215 1514 81 18 1 1510 255910266 255911731 0 2012
16 TraesCS5D01G082500 chr2A 92.356 1282 55 10 1 1261 718481749 718483008 0 1784
17 TraesCS5D01G082500 chr6A 89.666 1587 101 27 1 1556 579137646 579139200 0 1964
18 TraesCS5D01G082500 chr3B 93.364 874 45 6 1 861 440118667 440117794 0 1280
19 TraesCS5D01G082500 chr6D 96.107 745 24 3 813 1556 324750278 324749538 0 1210
20 TraesCS5D01G082500 chr5A 94.984 638 32 0 1554 2191 79136385 79135748 0 1002
21 TraesCS5D01G082500 chr5B 89.969 638 47 9 1558 2192 91442775 91442152 0 808


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G082500 chr5D 84379018 84381209 2191 True 4048 4048 100.000 1 2192 1 chr5D.!!$R1 2191
1 TraesCS5D01G082500 chr3D 80217780 80219319 1539 True 2601 2601 96.989 1 1558 1 chr3D.!!$R1 1557
2 TraesCS5D01G082500 chr2D 30080442 30082018 1576 True 2549 2549 96.073 1 1555 1 chr2D.!!$R1 1554
3 TraesCS5D01G082500 chr2D 30185275 30186810 1535 True 2516 2516 96.085 1 1555 1 chr2D.!!$R3 1554
4 TraesCS5D01G082500 chr2D 30142821 30143693 872 True 1491 1491 97.383 1 879 1 chr2D.!!$R2 878
5 TraesCS5D01G082500 chr4D 467821544 467823104 1560 True 2440 2440 94.949 3 1558 1 chr4D.!!$R1 1555
6 TraesCS5D01G082500 chr1A 7646344 7647868 1524 False 2353 2353 94.309 1 1558 1 chr1A.!!$F1 1557
7 TraesCS5D01G082500 chrUn 332491765 332493324 1559 True 2320 2320 93.679 4 1555 1 chrUn.!!$R1 1551
8 TraesCS5D01G082500 chrUn 111010659 111012145 1486 False 1631 1631 86.711 1 1480 1 chrUn.!!$F1 1479
9 TraesCS5D01G082500 chrUn 370576071 370576828 757 False 1251 1251 96.570 803 1555 1 chrUn.!!$F2 752
10 TraesCS5D01G082500 chr3A 572550175 572551623 1448 True 2148 2148 93.252 1 1478 1 chr3A.!!$R1 1477
11 TraesCS5D01G082500 chr2B 57915033 57916587 1554 False 2082 2082 90.961 1 1558 1 chr2B.!!$F1 1557
12 TraesCS5D01G082500 chr2B 54459749 54461307 1558 True 1930 1930 89.339 1 1558 1 chr2B.!!$R1 1557
13 TraesCS5D01G082500 chr7A 282556261 282557753 1492 False 2039 2039 91.026 1 1556 1 chr7A.!!$F2 1555
14 TraesCS5D01G082500 chr7A 90656404 90657861 1457 False 2015 2015 91.779 1 1456 1 chr7A.!!$F1 1455
15 TraesCS5D01G082500 chr2A 255910266 255911731 1465 False 2012 2012 91.215 1 1510 1 chr2A.!!$F1 1509
16 TraesCS5D01G082500 chr2A 718481749 718483008 1259 False 1784 1784 92.356 1 1261 1 chr2A.!!$F2 1260
17 TraesCS5D01G082500 chr6A 579137646 579139200 1554 False 1964 1964 89.666 1 1556 1 chr6A.!!$F1 1555
18 TraesCS5D01G082500 chr3B 440117794 440118667 873 True 1280 1280 93.364 1 861 1 chr3B.!!$R1 860
19 TraesCS5D01G082500 chr6D 324749538 324750278 740 True 1210 1210 96.107 813 1556 1 chr6D.!!$R1 743
20 TraesCS5D01G082500 chr5A 79135748 79136385 637 True 1002 1002 94.984 1554 2191 1 chr5A.!!$R1 637
21 TraesCS5D01G082500 chr5B 91442152 91442775 623 True 808 808 89.969 1558 2192 1 chr5B.!!$R1 634

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
949 1102 1.462035 GCTATGGCCACCATGGGAT 59.538 57.895 18.09 2.38 44.84 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1974 2193 0.76489 TTGGAGTAGTGCACCTTGCT 59.235 50.0 14.63 4.6 45.31 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
443 518 2.736995 CGAAGCCAAAGCGACCGA 60.737 61.111 0.00 0.00 46.67 4.69
715 791 4.130118 GGAGAAGCACTTGTTCTTCTTGA 58.870 43.478 14.69 0.00 46.32 3.02
949 1102 1.462035 GCTATGGCCACCATGGGAT 59.538 57.895 18.09 2.38 44.84 3.85
982 1135 1.767088 CTTCTCTCATGGGAGGCATGA 59.233 52.381 22.52 0.00 41.69 3.07
1051 1204 2.424601 CGCACACATTCCCATGAAGATT 59.575 45.455 0.00 0.00 33.05 2.40
1207 1396 6.276832 AGGAATGATGTGTCTTTCATTTGG 57.723 37.500 0.24 0.00 41.42 3.28
1308 1517 5.895636 TCTTCATCAACTTGTTTGTGTGT 57.104 34.783 0.00 0.00 36.49 3.72
1392 1604 0.476338 TATATGCAATGCCCCGGTGT 59.524 50.000 1.53 0.00 0.00 4.16
1596 1812 1.955778 CACAAACCCAGAGTGCAATCA 59.044 47.619 17.53 0.00 0.00 2.57
1868 2087 3.876309 AAAAACTTAGGACCAGCCTCA 57.124 42.857 0.00 0.00 46.97 3.86
1922 2141 9.584839 GATTACAAATTTGCTTCAATGTGAAAC 57.415 29.630 18.12 0.00 35.73 2.78
1938 2157 4.270084 TGTGAAACGTTGTGAAAGCTCTAG 59.730 41.667 0.00 0.00 42.39 2.43
1974 2193 3.138304 CGATCTCCAAAGGTGAACAACA 58.862 45.455 0.00 0.00 0.00 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
443 518 3.181466 GGTTTGTCTTTCTTGCACCCATT 60.181 43.478 0.00 0.00 0.00 3.16
715 791 3.009723 CCGCATTGAGGTTAGATGTGTT 58.990 45.455 0.00 0.00 31.21 3.32
949 1102 3.479489 TGAGAGAAGCAAAACTCATGCA 58.521 40.909 0.00 0.00 46.22 3.96
1051 1204 3.507233 GTGTTGGCAAGATCTTCAATGGA 59.493 43.478 4.57 0.00 0.00 3.41
1207 1396 8.309163 TCAAAATGCAAATCAAGTTCAATACC 57.691 30.769 0.00 0.00 0.00 2.73
1321 1530 9.269453 TGAAACATTCAAAATGCAATGAACATA 57.731 25.926 13.17 0.00 38.29 2.29
1773 1992 9.758651 CATGTTTGTGATGAATATCCAAATCAT 57.241 29.630 0.00 0.00 36.63 2.45
1868 2087 6.497954 TCTTCAAAAAGGAATTGGATGGTCAT 59.502 34.615 0.00 0.00 33.03 3.06
1922 2141 4.237724 TGATCACTAGAGCTTTCACAACG 58.762 43.478 0.00 0.00 0.00 4.10
1938 2157 3.547613 GGAGATCGCAATTGCTTGATCAC 60.548 47.826 32.08 28.15 39.09 3.06
1956 2175 2.297701 GCTGTTGTTCACCTTTGGAGA 58.702 47.619 0.00 0.00 0.00 3.71
1974 2193 0.764890 TTGGAGTAGTGCACCTTGCT 59.235 50.000 14.63 4.60 45.31 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.