Multiple sequence alignment - TraesCS5D01G080900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G080900 chr5D 100.000 2493 0 0 1 2493 80828716 80831208 0 4604
1 TraesCS5D01G080900 chr5D 97.862 2526 20 7 1 2493 335823506 335826030 0 4335
2 TraesCS5D01G080900 chr5D 97.824 2527 18 10 1 2493 55023999 55021476 0 4327
3 TraesCS5D01G080900 chr5D 97.881 1652 10 5 865 2493 442642101 442643750 0 2833
4 TraesCS5D01G080900 chr1D 98.411 2518 15 10 1 2493 143269201 143266684 0 4405
5 TraesCS5D01G080900 chr1D 97.941 2525 20 5 1 2493 203582847 203585371 0 4346
6 TraesCS5D01G080900 chr2D 98.015 2519 23 7 1 2493 54792982 54790465 0 4349
7 TraesCS5D01G080900 chr3D 97.901 2525 20 5 1 2493 68827264 68824741 0 4338
8 TraesCS5D01G080900 chr3D 97.982 892 8 2 1 882 414811281 414810390 0 1539
9 TraesCS5D01G080900 chr7D 97.823 2526 19 9 1 2493 567321997 567324519 0 4327
10 TraesCS5D01G080900 chr7D 97.618 2519 16 6 1 2493 403463712 403466212 0 4279
11 TraesCS5D01G080900 chr7D 96.774 2511 40 9 1 2488 118751756 118754248 0 4150
12 TraesCS5D01G080900 chr7D 97.506 1243 6 3 1276 2493 17735723 17736965 0 2100
13 TraesCS5D01G080900 chr4D 97.702 2524 26 5 1 2493 433308258 433305736 0 4311
14 TraesCS5D01G080900 chr4D 97.272 2529 30 11 1 2493 502304549 502307074 0 4252
15 TraesCS5D01G080900 chr6D 97.546 2526 28 9 1 2493 42264551 42262027 0 4290
16 TraesCS5D01G080900 chr6D 97.536 2516 30 8 1 2493 5280198 5277692 0 4274
17 TraesCS5D01G080900 chr6D 95.668 554 5 3 1958 2493 459303523 459302971 0 872


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G080900 chr5D 80828716 80831208 2492 False 4604 4604 100.000 1 2493 1 chr5D.!!$F1 2492
1 TraesCS5D01G080900 chr5D 335823506 335826030 2524 False 4335 4335 97.862 1 2493 1 chr5D.!!$F2 2492
2 TraesCS5D01G080900 chr5D 55021476 55023999 2523 True 4327 4327 97.824 1 2493 1 chr5D.!!$R1 2492
3 TraesCS5D01G080900 chr5D 442642101 442643750 1649 False 2833 2833 97.881 865 2493 1 chr5D.!!$F3 1628
4 TraesCS5D01G080900 chr1D 143266684 143269201 2517 True 4405 4405 98.411 1 2493 1 chr1D.!!$R1 2492
5 TraesCS5D01G080900 chr1D 203582847 203585371 2524 False 4346 4346 97.941 1 2493 1 chr1D.!!$F1 2492
6 TraesCS5D01G080900 chr2D 54790465 54792982 2517 True 4349 4349 98.015 1 2493 1 chr2D.!!$R1 2492
7 TraesCS5D01G080900 chr3D 68824741 68827264 2523 True 4338 4338 97.901 1 2493 1 chr3D.!!$R1 2492
8 TraesCS5D01G080900 chr3D 414810390 414811281 891 True 1539 1539 97.982 1 882 1 chr3D.!!$R2 881
9 TraesCS5D01G080900 chr7D 567321997 567324519 2522 False 4327 4327 97.823 1 2493 1 chr7D.!!$F4 2492
10 TraesCS5D01G080900 chr7D 403463712 403466212 2500 False 4279 4279 97.618 1 2493 1 chr7D.!!$F3 2492
11 TraesCS5D01G080900 chr7D 118751756 118754248 2492 False 4150 4150 96.774 1 2488 1 chr7D.!!$F2 2487
12 TraesCS5D01G080900 chr7D 17735723 17736965 1242 False 2100 2100 97.506 1276 2493 1 chr7D.!!$F1 1217
13 TraesCS5D01G080900 chr4D 433305736 433308258 2522 True 4311 4311 97.702 1 2493 1 chr4D.!!$R1 2492
14 TraesCS5D01G080900 chr4D 502304549 502307074 2525 False 4252 4252 97.272 1 2493 1 chr4D.!!$F1 2492
15 TraesCS5D01G080900 chr6D 42262027 42264551 2524 True 4290 4290 97.546 1 2493 1 chr6D.!!$R2 2492
16 TraesCS5D01G080900 chr6D 5277692 5280198 2506 True 4274 4274 97.536 1 2493 1 chr6D.!!$R1 2492
17 TraesCS5D01G080900 chr6D 459302971 459303523 552 True 872 872 95.668 1958 2493 1 chr6D.!!$R3 535

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
660 697 2.10795 TTACGATCTGCCCCACTTTG 57.892 50.0 0.0 0.0 0.0 2.77 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1553 1686 3.182572 CGACAGTTGCACTAAACAGAGTC 59.817 47.826 0.0 0.0 32.21 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
660 697 2.107950 TTACGATCTGCCCCACTTTG 57.892 50.000 0.00 0.0 0.00 2.77
1553 1686 5.122239 TCCAAGTCTGTTTATCTCAAATGCG 59.878 40.000 0.00 0.0 0.00 4.73
1598 1731 7.383572 GTCGATCTCTGAATGTATGCAGTTTAT 59.616 37.037 0.00 0.0 33.90 1.40
1852 1986 4.322499 CCCAAAGAGAATCAAGCTGCAATT 60.322 41.667 1.02 0.0 37.82 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
240 270 6.875948 TGTTGTAATTCTTGTGCACATAGT 57.124 33.333 22.39 11.0 0.00 2.12
660 697 7.893824 TGTGCGAAAAATACAATTTCATATGC 58.106 30.769 0.00 0.0 36.75 3.14
1553 1686 3.182572 CGACAGTTGCACTAAACAGAGTC 59.817 47.826 0.00 0.0 32.21 3.36
1852 1986 3.364549 CTCATTTATCCTTTGTGGGCCA 58.635 45.455 0.00 0.0 36.20 5.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.