Multiple sequence alignment - TraesCS5D01G079900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G079900 chr5D 100.000 2297 0 0 1 2297 80104931 80102635 0.000000e+00 4242
1 TraesCS5D01G079900 chr5D 96.502 829 28 1 1 828 555235428 555236256 0.000000e+00 1369
2 TraesCS5D01G079900 chr5D 98.361 61 1 0 2212 2272 213477771 213477711 8.680000e-20 108
3 TraesCS5D01G079900 chr6D 97.273 2310 50 5 1 2297 430467636 430465327 0.000000e+00 3904
4 TraesCS5D01G079900 chr6D 96.394 1941 54 5 148 2076 370001600 369999664 0.000000e+00 3182
5 TraesCS5D01G079900 chr6D 93.695 1919 105 8 292 2206 183386761 183384855 0.000000e+00 2859
6 TraesCS5D01G079900 chr3D 96.550 2319 58 4 1 2297 202626342 202624024 0.000000e+00 3819
7 TraesCS5D01G079900 chr3D 96.294 1700 63 0 598 2297 498443588 498445287 0.000000e+00 2791
8 TraesCS5D01G079900 chr3D 90.378 925 76 8 2 921 576907517 576906601 0.000000e+00 1203
9 TraesCS5D01G079900 chr4D 96.577 2308 68 2 1 2297 97360967 97363274 0.000000e+00 3814
10 TraesCS5D01G079900 chr4D 95.565 2255 90 6 1 2253 241310181 241312427 0.000000e+00 3602
11 TraesCS5D01G079900 chr4D 94.725 2313 106 4 1 2297 241247480 241249792 0.000000e+00 3581
12 TraesCS5D01G079900 chr4D 96.163 808 25 2 1 802 135047381 135048188 0.000000e+00 1315
13 TraesCS5D01G079900 chr1D 96.319 2309 73 3 1 2297 350976818 350979126 0.000000e+00 3783
14 TraesCS5D01G079900 chrUn 96.039 1439 36 3 1 1418 275334254 275335692 0.000000e+00 2322
15 TraesCS5D01G079900 chr4A 94.898 1176 54 2 1 1170 295191753 295190578 0.000000e+00 1834
16 TraesCS5D01G079900 chr4A 94.572 829 44 1 1 828 280930076 280930904 0.000000e+00 1280
17 TraesCS5D01G079900 chr4A 93.258 89 6 0 2209 2297 564860934 564861022 5.150000e-27 132
18 TraesCS5D01G079900 chr5A 96.703 91 3 0 2207 2297 55022084 55022174 3.950000e-33 152
19 TraesCS5D01G079900 chr6B 97.701 87 2 0 2211 2297 621321410 621321324 1.420000e-32 150


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G079900 chr5D 80102635 80104931 2296 True 4242 4242 100.000 1 2297 1 chr5D.!!$R1 2296
1 TraesCS5D01G079900 chr5D 555235428 555236256 828 False 1369 1369 96.502 1 828 1 chr5D.!!$F1 827
2 TraesCS5D01G079900 chr6D 430465327 430467636 2309 True 3904 3904 97.273 1 2297 1 chr6D.!!$R3 2296
3 TraesCS5D01G079900 chr6D 369999664 370001600 1936 True 3182 3182 96.394 148 2076 1 chr6D.!!$R2 1928
4 TraesCS5D01G079900 chr6D 183384855 183386761 1906 True 2859 2859 93.695 292 2206 1 chr6D.!!$R1 1914
5 TraesCS5D01G079900 chr3D 202624024 202626342 2318 True 3819 3819 96.550 1 2297 1 chr3D.!!$R1 2296
6 TraesCS5D01G079900 chr3D 498443588 498445287 1699 False 2791 2791 96.294 598 2297 1 chr3D.!!$F1 1699
7 TraesCS5D01G079900 chr3D 576906601 576907517 916 True 1203 1203 90.378 2 921 1 chr3D.!!$R2 919
8 TraesCS5D01G079900 chr4D 97360967 97363274 2307 False 3814 3814 96.577 1 2297 1 chr4D.!!$F1 2296
9 TraesCS5D01G079900 chr4D 241310181 241312427 2246 False 3602 3602 95.565 1 2253 1 chr4D.!!$F4 2252
10 TraesCS5D01G079900 chr4D 241247480 241249792 2312 False 3581 3581 94.725 1 2297 1 chr4D.!!$F3 2296
11 TraesCS5D01G079900 chr4D 135047381 135048188 807 False 1315 1315 96.163 1 802 1 chr4D.!!$F2 801
12 TraesCS5D01G079900 chr1D 350976818 350979126 2308 False 3783 3783 96.319 1 2297 1 chr1D.!!$F1 2296
13 TraesCS5D01G079900 chrUn 275334254 275335692 1438 False 2322 2322 96.039 1 1418 1 chrUn.!!$F1 1417
14 TraesCS5D01G079900 chr4A 295190578 295191753 1175 True 1834 1834 94.898 1 1170 1 chr4A.!!$R1 1169
15 TraesCS5D01G079900 chr4A 280930076 280930904 828 False 1280 1280 94.572 1 828 1 chr4A.!!$F1 827

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
532 539 1.026718 GTGGAATGAGGCTGGAACCG 61.027 60.0 0.0 0.0 33.69 4.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1548 1623 0.402121 GGGGAGTATGAGGAATGCCC 59.598 60.0 0.0 0.0 36.05 5.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
171 173 1.822990 TCCAATCGACTTTAGGAGCGT 59.177 47.619 0.00 0.00 0.00 5.07
186 188 5.140747 AGGAGCGTCATATGTTTCTATCC 57.859 43.478 1.90 4.78 0.00 2.59
228 230 4.942483 TCGCTATAAGGGTCATAGCTAGTC 59.058 45.833 11.38 0.00 45.71 2.59
300 302 2.747989 GGGAGCTAGCCTTTGTGTTAAC 59.252 50.000 12.13 0.00 0.00 2.01
532 539 1.026718 GTGGAATGAGGCTGGAACCG 61.027 60.000 0.00 0.00 33.69 4.44
652 725 4.176271 CTGAATATCGTGAGTGTTCAGCA 58.824 43.478 0.00 0.00 37.73 4.41
736 810 7.882791 TGGTTATAAGAGAATGTTGCTCTTCAA 59.117 33.333 8.93 3.50 46.75 2.69
822 896 5.769662 ACTAGCATTTTGTCATGGAAGTTCA 59.230 36.000 5.01 0.00 0.00 3.18
886 960 3.574396 ACGTCAAGATCAGTCTCCTTTCA 59.426 43.478 0.00 0.00 32.15 2.69
892 966 6.877855 TCAAGATCAGTCTCCTTTCATTTCTG 59.122 38.462 0.00 0.00 32.15 3.02
1060 1134 3.367630 GCAATTGGTAAACTTTCGCATGG 59.632 43.478 7.72 0.00 0.00 3.66
1063 1137 2.156098 TGGTAAACTTTCGCATGGTCC 58.844 47.619 0.00 0.00 0.00 4.46
1207 1281 1.689813 TGGTCAAAGTAGGAGTCGCAA 59.310 47.619 0.00 0.00 0.00 4.85
1286 1360 0.745845 CGTTGGATCCTTGGAGCAGG 60.746 60.000 14.23 0.00 34.86 4.85
1306 1380 5.569413 CAGGTTTCAAATGACGTATAAGCC 58.431 41.667 0.00 0.00 0.00 4.35
1341 1416 7.122353 AGCTTAGAGAAATGTTCATTTGCTGAT 59.878 33.333 14.29 6.47 32.72 2.90
1362 1437 7.004555 TGATATACTGGATGCTTACCGAAAT 57.995 36.000 0.00 0.00 0.00 2.17
1396 1471 4.404715 CACGTAAGAGAAGGGGGAATCTTA 59.595 45.833 0.00 0.00 43.62 2.10
1552 1627 8.853126 CATCTTCATATAGAAAGAAAATGGGCA 58.147 33.333 4.27 0.00 35.40 5.36
1588 1666 4.133078 CCCTTCATTCATAGAGTTGGAGC 58.867 47.826 0.00 0.00 0.00 4.70
1947 2026 1.037579 GCTTTTTCCCCTATGCCGCT 61.038 55.000 0.00 0.00 0.00 5.52
2164 2243 1.429930 TGGCAAGCGATCCCCTATTA 58.570 50.000 0.00 0.00 0.00 0.98
2183 2262 2.835580 ATGCATCCCGAAGATCAGAG 57.164 50.000 0.00 0.00 30.59 3.35
2280 2363 6.833933 AGTTTCTTAGTCTTTTGGTCCACATT 59.166 34.615 0.00 0.00 0.00 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 9.319143 GCTAGTTCAAGTTCACATCATATTAGT 57.681 33.333 0.00 0.00 0.00 2.24
186 188 1.725164 GAGCCTCACTTTACCGTTTCG 59.275 52.381 0.00 0.00 0.00 3.46
532 539 3.921677 TCCCGGTTTAGCGATATTGATC 58.078 45.455 0.00 0.00 0.00 2.92
736 810 2.103537 AGGCCACTATACGCGTTTTT 57.896 45.000 20.78 5.57 0.00 1.94
822 896 8.647226 CAACGAAAAACAAGAACTTTCTTTCAT 58.353 29.630 1.28 0.00 44.70 2.57
886 960 3.077359 CTCTGCTCCCGAAAACAGAAAT 58.923 45.455 0.00 0.00 38.61 2.17
892 966 0.320771 TCAGCTCTGCTCCCGAAAAC 60.321 55.000 0.00 0.00 36.40 2.43
1039 1113 4.555262 ACCATGCGAAAGTTTACCAATTG 58.445 39.130 0.00 0.00 0.00 2.32
1060 1134 4.566987 ACTCTCGTTCTTTTACCATGGAC 58.433 43.478 21.47 2.69 0.00 4.02
1207 1281 7.931015 TCCCAGGAACATCATAAATAGTACT 57.069 36.000 0.00 0.00 0.00 2.73
1286 1360 5.933790 TGTGGCTTATACGTCATTTGAAAC 58.066 37.500 0.00 0.00 0.00 2.78
1306 1380 7.550551 TGAACATTTCTCTAAGCTTATCCTGTG 59.449 37.037 6.64 5.22 0.00 3.66
1341 1416 6.070995 CCCTATTTCGGTAAGCATCCAGTATA 60.071 42.308 0.00 0.00 0.00 1.47
1362 1437 5.105064 CCTTCTCTTACGTGAAATTCCCCTA 60.105 44.000 0.00 0.00 0.00 3.53
1462 1537 2.165234 TGACTGAATGAGGAAGAGCTCG 59.835 50.000 8.37 0.00 0.00 5.03
1548 1623 0.402121 GGGGAGTATGAGGAATGCCC 59.598 60.000 0.00 0.00 36.05 5.36
1552 1627 3.438131 TGAAGGGGGAGTATGAGGAAT 57.562 47.619 0.00 0.00 0.00 3.01
1588 1666 1.318158 GGCAGGCCTCTTGTGGATTG 61.318 60.000 0.00 0.00 0.00 2.67
1947 2026 7.289317 CCAATCCTACTCCACTAGTACCAATAA 59.711 40.741 0.00 0.00 39.80 1.40
2164 2243 1.347050 CCTCTGATCTTCGGGATGCAT 59.653 52.381 0.00 0.00 34.33 3.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.