Multiple sequence alignment - TraesCS5D01G078000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G078000 chr5D 100.000 2228 0 0 1 2228 77882637 77884864 0 4115
1 TraesCS5D01G078000 chr5D 97.671 2233 46 5 1 2228 371071741 371073972 0 3831
2 TraesCS5D01G078000 chr5D 97.540 2236 47 3 1 2228 26829394 26831629 0 3818
3 TraesCS5D01G078000 chr7D 97.892 2230 43 3 1 2228 230444029 230441802 0 3855
4 TraesCS5D01G078000 chr7D 97.628 2234 47 4 1 2228 452961292 452963525 0 3827
5 TraesCS5D01G078000 chr7D 97.404 2234 52 5 1 2228 102563558 102561325 0 3799
6 TraesCS5D01G078000 chr7D 97.004 2236 58 7 1 2228 632553527 632555761 0 3749
7 TraesCS5D01G078000 chr7D 97.302 2150 46 5 90 2228 196132358 196130210 0 3639
8 TraesCS5D01G078000 chr1D 97.672 2234 46 4 1 2228 431409456 431407223 0 3832
9 TraesCS5D01G078000 chr2D 97.625 2232 45 5 1 2228 536996189 536998416 0 3821
10 TraesCS5D01G078000 chr2D 97.098 2240 52 5 1 2228 299356993 299359231 0 3764


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G078000 chr5D 77882637 77884864 2227 False 4115 4115 100.000 1 2228 1 chr5D.!!$F2 2227
1 TraesCS5D01G078000 chr5D 371071741 371073972 2231 False 3831 3831 97.671 1 2228 1 chr5D.!!$F3 2227
2 TraesCS5D01G078000 chr5D 26829394 26831629 2235 False 3818 3818 97.540 1 2228 1 chr5D.!!$F1 2227
3 TraesCS5D01G078000 chr7D 230441802 230444029 2227 True 3855 3855 97.892 1 2228 1 chr7D.!!$R3 2227
4 TraesCS5D01G078000 chr7D 452961292 452963525 2233 False 3827 3827 97.628 1 2228 1 chr7D.!!$F1 2227
5 TraesCS5D01G078000 chr7D 102561325 102563558 2233 True 3799 3799 97.404 1 2228 1 chr7D.!!$R1 2227
6 TraesCS5D01G078000 chr7D 632553527 632555761 2234 False 3749 3749 97.004 1 2228 1 chr7D.!!$F2 2227
7 TraesCS5D01G078000 chr7D 196130210 196132358 2148 True 3639 3639 97.302 90 2228 1 chr7D.!!$R2 2138
8 TraesCS5D01G078000 chr1D 431407223 431409456 2233 True 3832 3832 97.672 1 2228 1 chr1D.!!$R1 2227
9 TraesCS5D01G078000 chr2D 536996189 536998416 2227 False 3821 3821 97.625 1 2228 1 chr2D.!!$F2 2227
10 TraesCS5D01G078000 chr2D 299356993 299359231 2238 False 3764 3764 97.098 1 2228 1 chr2D.!!$F1 2227

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
909 938 0.676782 TGACGCTCGAGGATGTCTCA 60.677 55.0 15.58 1.37 42.55 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2195 2227 0.106708 GGCGGGCATATCTCAACTCA 59.893 55.0 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
700 729 4.514401 ACCTTTGAAGATTCGGTATCACC 58.486 43.478 0.00 0.00 35.59 4.02
849 878 3.785859 GCTGATCGGTGGAGGCCA 61.786 66.667 5.01 0.00 0.00 5.36
864 893 2.488153 GAGGCCAAAGACGCATAGTTTT 59.512 45.455 5.01 0.00 0.00 2.43
889 918 1.685765 CGGACTGGGGAGATGACCA 60.686 63.158 0.00 0.00 35.05 4.02
909 938 0.676782 TGACGCTCGAGGATGTCTCA 60.677 55.000 15.58 1.37 42.55 3.27
1185 1214 1.964933 TGGTATGTTGTGTCGAGGACA 59.035 47.619 0.00 0.00 40.50 4.02
1226 1255 2.905075 CAAGAACGCTCCATGGATGTA 58.095 47.619 16.63 0.00 0.00 2.29
1274 1303 2.648059 CAAATGGAGCTAGGGTTCAGG 58.352 52.381 0.00 0.00 0.00 3.86
1594 1624 1.471287 TCCGAGATGACGAACGATGTT 59.529 47.619 0.14 0.00 35.09 2.71
1638 1668 1.206132 TGCCGAGTTGGACACGATTAT 59.794 47.619 0.00 0.00 42.00 1.28
1688 1718 3.507233 TCAGTCATTTCTCATGTTTGCCC 59.493 43.478 0.00 0.00 0.00 5.36
1821 1853 2.808919 CTTGCGGGATAGGGATCTCTA 58.191 52.381 4.38 4.38 29.28 2.43
1883 1915 2.153945 CATTTGCCACATCGCGTGC 61.154 57.895 5.77 3.15 44.91 5.34
1940 1972 3.551846 GAATGGGTGGATACGGACAAAT 58.448 45.455 0.00 0.00 42.51 2.32
1977 2009 4.339530 AGAGAGCGTATTGACTAAGCATCA 59.660 41.667 0.00 0.00 37.30 3.07
2195 2227 7.336931 ACATACGATGGCTTCTTGAAAATACTT 59.663 33.333 0.00 0.00 33.60 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
236 263 7.488150 TCTCACATATAGCTACAAAACTCAACG 59.512 37.037 0.00 0.00 0.00 4.10
440 468 7.692291 CGGTAAACACTCAACATTTCATATGTC 59.308 37.037 1.90 0.00 0.00 3.06
700 729 3.775654 GGCAGGACCAGAGACCCG 61.776 72.222 0.00 0.00 38.86 5.28
849 878 5.163854 CCGAAGATGAAAACTATGCGTCTTT 60.164 40.000 0.00 0.00 37.84 2.52
864 893 0.335019 TCTCCCCAGTCCGAAGATGA 59.665 55.000 0.00 0.00 0.00 2.92
889 918 0.665835 GAGACATCCTCGAGCGTCAT 59.334 55.000 22.15 12.05 31.32 3.06
909 938 3.733337 GATAGCAAGACCGGTGATCAAT 58.267 45.455 14.63 0.00 0.00 2.57
1031 1060 2.729194 TCTTCTTCTCTTCTCCCTCCG 58.271 52.381 0.00 0.00 0.00 4.63
1185 1214 2.815589 GCCAGTGGAGTCAGGAAACAAT 60.816 50.000 15.20 0.00 0.00 2.71
1226 1255 0.674895 GATGGTCAACGCCTTCAGCT 60.675 55.000 0.00 0.00 40.39 4.24
1265 1294 1.492993 GGCAAGAGTCCCTGAACCCT 61.493 60.000 0.00 0.00 0.00 4.34
1274 1303 2.416972 CGGTACAAGTAGGCAAGAGTCC 60.417 54.545 0.00 0.00 0.00 3.85
1883 1915 2.544267 GGAACAGACCAAACTGACGAAG 59.456 50.000 0.00 0.00 40.63 3.79
1940 1972 4.270834 ACGCTCTCTTACCTATGAAGTGA 58.729 43.478 0.00 0.00 0.00 3.41
1977 2009 7.395489 ACATTAGCAAAATCAAGAAGGACTGAT 59.605 33.333 0.00 0.00 0.00 2.90
2195 2227 0.106708 GGCGGGCATATCTCAACTCA 59.893 55.000 0.00 0.00 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.