Multiple sequence alignment - TraesCS5D01G065200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G065200 chr5D 100.000 2264 0 0 1 2264 60521573 60519310 0 4181
1 TraesCS5D01G065200 chr7D 97.089 2267 59 6 1 2264 463977651 463979913 0 3814
2 TraesCS5D01G065200 chr2D 97.045 2267 60 6 1 2264 63681763 63684025 0 3808
3 TraesCS5D01G065200 chr4D 97.471 2214 51 4 53 2264 496006351 496008561 0 3773
4 TraesCS5D01G065200 chr6D 96.683 2261 69 5 1 2259 80672963 80670707 0 3755
5 TraesCS5D01G065200 chr3B 96.528 2218 70 6 1 2214 141753921 141756135 0 3663
6 TraesCS5D01G065200 chr7A 95.966 2256 83 7 13 2264 89990547 89988296 0 3655
7 TraesCS5D01G065200 chr3A 95.469 2273 90 11 1 2264 328922715 328924983 0 3615
8 TraesCS5D01G065200 chr2B 95.485 2259 89 10 1 2251 90758895 90761148 0 3594
9 TraesCS5D01G065200 chr1B 95.310 2260 93 10 1 2251 615476991 615479246 0 3574


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G065200 chr5D 60519310 60521573 2263 True 4181 4181 100.000 1 2264 1 chr5D.!!$R1 2263
1 TraesCS5D01G065200 chr7D 463977651 463979913 2262 False 3814 3814 97.089 1 2264 1 chr7D.!!$F1 2263
2 TraesCS5D01G065200 chr2D 63681763 63684025 2262 False 3808 3808 97.045 1 2264 1 chr2D.!!$F1 2263
3 TraesCS5D01G065200 chr4D 496006351 496008561 2210 False 3773 3773 97.471 53 2264 1 chr4D.!!$F1 2211
4 TraesCS5D01G065200 chr6D 80670707 80672963 2256 True 3755 3755 96.683 1 2259 1 chr6D.!!$R1 2258
5 TraesCS5D01G065200 chr3B 141753921 141756135 2214 False 3663 3663 96.528 1 2214 1 chr3B.!!$F1 2213
6 TraesCS5D01G065200 chr7A 89988296 89990547 2251 True 3655 3655 95.966 13 2264 1 chr7A.!!$R1 2251
7 TraesCS5D01G065200 chr3A 328922715 328924983 2268 False 3615 3615 95.469 1 2264 1 chr3A.!!$F1 2263
8 TraesCS5D01G065200 chr2B 90758895 90761148 2253 False 3594 3594 95.485 1 2251 1 chr2B.!!$F1 2250
9 TraesCS5D01G065200 chr1B 615476991 615479246 2255 False 3574 3574 95.310 1 2251 1 chr1B.!!$F1 2250

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
495 507 0.315568 CGATGATCTCCGGTCTTCCC 59.684 60.0 0.0 0.0 0.0 3.97 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1822 1839 1.3382 CCATAATCTAGGTGCGCTCCC 60.338 57.143 24.18 16.17 0.0 4.3 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
124 131 4.307432 CGGCCTTGATGATTATTACGAGT 58.693 43.478 0.00 0.00 0.00 4.18
495 507 0.315568 CGATGATCTCCGGTCTTCCC 59.684 60.000 0.00 0.00 0.00 3.97
535 547 1.257743 CGGGAAGGTGAAGTCTGAGA 58.742 55.000 0.00 0.00 0.00 3.27
627 639 2.026262 TCCTAGGCCATCTGGTGTTTTC 60.026 50.000 5.01 0.00 37.57 2.29
679 691 0.902048 CCCAGAGAGTGCCAGTCTGA 60.902 60.000 6.82 0.00 40.21 3.27
706 718 1.455217 GAGAGGTACGCCAGGGCTA 60.455 63.158 8.91 0.00 39.32 3.93
916 929 7.083858 GCATGTGATTGTTTAATGTGTGTACT 58.916 34.615 0.00 0.00 0.00 2.73
931 944 1.616374 TGTACTCGGTCATGCAGTTGA 59.384 47.619 0.00 0.00 0.00 3.18
998 1011 4.390129 TTGTTTGGGCCCTACAGATTTA 57.610 40.909 25.70 8.92 0.00 1.40
1226 1239 1.105457 TGCCTTGCCATCATTACAGC 58.895 50.000 0.00 0.00 0.00 4.40
1227 1240 1.341285 TGCCTTGCCATCATTACAGCT 60.341 47.619 0.00 0.00 0.00 4.24
1315 1330 0.251077 AGGCAGTTCCCTTTGAGCAG 60.251 55.000 0.00 0.00 34.51 4.24
1368 1383 1.174712 GCGTTGCCCCATGATATGCT 61.175 55.000 0.00 0.00 0.00 3.79
1754 1771 2.280797 GTGCTTGGACTCGTGCCA 60.281 61.111 0.00 0.00 0.00 4.92
1794 1811 1.002868 GTGAGGCTGCTGATGGTGT 60.003 57.895 0.00 0.00 0.00 4.16
2003 2020 1.352156 GCGCACCTGGTAGAGAAACG 61.352 60.000 0.30 0.00 0.00 3.60
2044 2062 2.696187 CTCTACAGGTTAGAGGCCTTCC 59.304 54.545 6.77 7.94 37.87 3.46
2113 2133 4.099881 ACATGTCAATGTCTTTGCCTTTGT 59.900 37.500 0.00 0.00 43.85 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
139 146 2.122768 CTCCCCTCTTTCCACTAGCAT 58.877 52.381 0.00 0.00 0.00 3.79
376 388 1.588139 CGGTAATGGCCGTCGAGTC 60.588 63.158 0.00 0.00 46.11 3.36
398 410 1.905512 GGCCTCCAACAGTCCGTAT 59.094 57.895 0.00 0.00 0.00 3.06
406 418 3.691342 CGTCTCCGGCCTCCAACA 61.691 66.667 0.00 0.00 0.00 3.33
495 507 1.402896 TAAGAGCCCTGCCCTCGATG 61.403 60.000 0.00 0.00 34.56 3.84
535 547 1.528309 CAACCCTTTGTCGCCACCT 60.528 57.895 0.00 0.00 0.00 4.00
679 691 0.317479 GCGTACCTCTCCACAACAGT 59.683 55.000 0.00 0.00 0.00 3.55
706 718 6.782494 ACTTGGGTCAAAAGATTCCATAAGTT 59.218 34.615 0.00 0.00 30.59 2.66
741 753 3.681835 GTGTCTCCCGTGCCGTCT 61.682 66.667 0.00 0.00 0.00 4.18
916 929 0.948623 CCGTTCAACTGCATGACCGA 60.949 55.000 8.61 0.00 37.41 4.69
931 944 2.111384 ACTCCTCATACATGCTCCGTT 58.889 47.619 0.00 0.00 0.00 4.44
1315 1330 1.463444 GTTGGTCACGAAGGCACATAC 59.537 52.381 0.00 0.00 0.00 2.39
1411 1426 4.023878 GGTGCGTTGTTGTACTCCAAATTA 60.024 41.667 0.00 0.00 34.07 1.40
1754 1771 4.888326 TTGGCATTACTTCCAAGCAATT 57.112 36.364 0.00 0.00 37.43 2.32
1794 1811 8.998814 TGGTCTCCCTAATAGAATTGTTGAATA 58.001 33.333 0.00 0.00 0.00 1.75
1822 1839 1.338200 CCATAATCTAGGTGCGCTCCC 60.338 57.143 24.18 16.17 0.00 4.30
2113 2133 3.071479 GGCAACGATTCACAACCTTCTA 58.929 45.455 0.00 0.00 0.00 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.