AutoCloner

Multiple sequence alignment - TraesCS5D01G065000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS5D01G065000	chr5D	100.000	3643	0	0	1	3643	60466142	60469784	0.000000e+00	6728
1	TraesCS5D01G065000	chr5D	91.889	937	71	5	2	936	60255752	60254819	0.000000e+00	1304
2	TraesCS5D01G065000	chr5D	93.612	814	52	0	2830	3643	41696389	41695576	0.000000e+00	1216
3	TraesCS5D01G065000	chr5D	86.752	234	16	8	1434	1666	3967382	3967601	2.810000e-61	246
4	TraesCS5D01G065000	chr5A	93.774	1044	47	8	932	1964	48881008	48882044	0.000000e+00	1552
5	TraesCS5D01G065000	chr5A	92.766	788	46	5	2028	2807	48882417	48883201	0.000000e+00	1129
6	TraesCS5D01G065000	chr5A	80.137	146	24	4	1019	1162	572500591	572500449	1.790000e-18	104
7	TraesCS5D01G065000	chr2D	93.355	933	56	6	2	931	276936604	276935675	0.000000e+00	1375
8	TraesCS5D01G065000	chr2D	93.041	934	62	3	2	935	285349158	285350088	0.000000e+00	1362
9	TraesCS5D01G065000	chr2D	93.742	815	49	2	2829	3643	30355182	30355994	0.000000e+00	1221
10	TraesCS5D01G065000	chr7D	93.333	930	57	3	2	928	145919904	145918977	0.000000e+00	1369
11	TraesCS5D01G065000	chr7D	92.696	931	61	7	2	928	616465764	616464837	0.000000e+00	1336
12	TraesCS5D01G065000	chr7D	92.680	929	61	6	2	927	164762035	164761111	0.000000e+00	1332
13	TraesCS5D01G065000	chr7D	92.672	928	61	5	2	928	576644888	576643967	0.000000e+00	1330
14	TraesCS5D01G065000	chr1D	92.565	928	65	4	2	928	481641433	481642357	0.000000e+00	1328
15	TraesCS5D01G065000	chr6B	92.275	932	63	8	4	934	626810098	626809175	0.000000e+00	1314
16	TraesCS5D01G065000	chr3D	94.002	817	47	1	2827	3643	11422411	11421597	0.000000e+00	1236
17	TraesCS5D01G065000	chr3D	93.627	816	49	1	2828	3643	581791739	581792551	0.000000e+00	1216
18	TraesCS5D01G065000	chr5B	92.875	814	58	0	2830	3643	161154909	161155722	0.000000e+00	1182
19	TraesCS5D01G065000	chr5B	93.569	622	36	3	2195	2814	70277460	70276841	0.000000e+00	924
20	TraesCS5D01G065000	chr5B	80.741	135	24	2	1033	1167	553947841	553947973	1.790000e-18	104
21	TraesCS5D01G065000	chr6D	92.883	815	54	2	2829	3643	445039460	445040270	0.000000e+00	1181
22	TraesCS5D01G065000	chr6D	83.709	577	85	7	2056	2630	14187282	14187851	1.490000e-148	536
23	TraesCS5D01G065000	chr6D	80.769	572	96	9	2061	2630	14204881	14205440	5.590000e-118	435
24	TraesCS5D01G065000	chr6D	81.944	216	30	6	1019	1226	281845056	281845270	1.340000e-39	174
25	TraesCS5D01G065000	chrUn	92.289	830	62	2	2814	3643	29278717	29279544	0.000000e+00	1177
26	TraesCS5D01G065000	chr7B	92.326	821	57	5	2828	3643	725969220	725970039	0.000000e+00	1162
27	TraesCS5D01G065000	chr4B	92.270	815	63	0	2829	3643	103018606	103017792	0.000000e+00	1157
28	TraesCS5D01G065000	chr6A	86.667	555	52	7	1019	1551	15452686	15453240	2.420000e-166	595
29	TraesCS5D01G065000	chr6A	83.226	620	88	12	2013	2630	15454611	15455216	4.110000e-154	555

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS5D01G065000	chr5D	60466142	60469784	3642	False	6728.0	6728	100.0000	1	3643	1	chr5D.!!$F2	3642
1	TraesCS5D01G065000	chr5D	60254819	60255752	933	True	1304.0	1304	91.8890	2	936	1	chr5D.!!$R2	934
2	TraesCS5D01G065000	chr5D	41695576	41696389	813	True	1216.0	1216	93.6120	2830	3643	1	chr5D.!!$R1	813
3	TraesCS5D01G065000	chr5A	48881008	48883201	2193	False	1340.5	1552	93.2700	932	2807	2	chr5A.!!$F1	1875
4	TraesCS5D01G065000	chr2D	276935675	276936604	929	True	1375.0	1375	93.3550	2	931	1	chr2D.!!$R1	929
5	TraesCS5D01G065000	chr2D	285349158	285350088	930	False	1362.0	1362	93.0410	2	935	1	chr2D.!!$F2	933
6	TraesCS5D01G065000	chr2D	30355182	30355994	812	False	1221.0	1221	93.7420	2829	3643	1	chr2D.!!$F1	814
7	TraesCS5D01G065000	chr7D	145918977	145919904	927	True	1369.0	1369	93.3330	2	928	1	chr7D.!!$R1	926
8	TraesCS5D01G065000	chr7D	616464837	616465764	927	True	1336.0	1336	92.6960	2	928	1	chr7D.!!$R4	926
9	TraesCS5D01G065000	chr7D	164761111	164762035	924	True	1332.0	1332	92.6800	2	927	1	chr7D.!!$R2	925
10	TraesCS5D01G065000	chr7D	576643967	576644888	921	True	1330.0	1330	92.6720	2	928	1	chr7D.!!$R3	926
11	TraesCS5D01G065000	chr1D	481641433	481642357	924	False	1328.0	1328	92.5650	2	928	1	chr1D.!!$F1	926
12	TraesCS5D01G065000	chr6B	626809175	626810098	923	True	1314.0	1314	92.2750	4	934	1	chr6B.!!$R1	930
13	TraesCS5D01G065000	chr3D	11421597	11422411	814	True	1236.0	1236	94.0020	2827	3643	1	chr3D.!!$R1	816
14	TraesCS5D01G065000	chr3D	581791739	581792551	812	False	1216.0	1216	93.6270	2828	3643	1	chr3D.!!$F1	815
15	TraesCS5D01G065000	chr5B	161154909	161155722	813	False	1182.0	1182	92.8750	2830	3643	1	chr5B.!!$F1	813
16	TraesCS5D01G065000	chr5B	70276841	70277460	619	True	924.0	924	93.5690	2195	2814	1	chr5B.!!$R1	619
17	TraesCS5D01G065000	chr6D	445039460	445040270	810	False	1181.0	1181	92.8830	2829	3643	1	chr6D.!!$F4	814
18	TraesCS5D01G065000	chr6D	14187282	14187851	569	False	536.0	536	83.7090	2056	2630	1	chr6D.!!$F1	574
19	TraesCS5D01G065000	chr6D	14204881	14205440	559	False	435.0	435	80.7690	2061	2630	1	chr6D.!!$F2	569
20	TraesCS5D01G065000	chrUn	29278717	29279544	827	False	1177.0	1177	92.2890	2814	3643	1	chrUn.!!$F1	829
21	TraesCS5D01G065000	chr7B	725969220	725970039	819	False	1162.0	1162	92.3260	2828	3643	1	chr7B.!!$F1	815
22	TraesCS5D01G065000	chr4B	103017792	103018606	814	True	1157.0	1157	92.2700	2829	3643	1	chr4B.!!$R1	814
23	TraesCS5D01G065000	chr6A	15452686	15455216	2530	False	575.0	595	84.9465	1019	2630	2	chr6A.!!$F1	1611

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability	Orientation
886	899	0.179121	GACGCGGATCCATGTGTGTA	60.179	55.0	12.47	0.00	2.90	F
994	1007	0.885196	GGCGAGTGAGAGAGTCAACT	59.115	55.0	0.00	36.74	3.16	F
2235	3614	1.192146	TGACCGAGGAAGAACTGGGG	61.192	60.0	0.00	40.29	4.96	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2103	3482	0.167470	TCTTTAGGACAGTCGCGACG	59.833	55.0	31.56	26.74	36.20	5.12	R
2457	3839	0.666577	CCAAAGGACTCGACACCGAC	60.667	60.0	0.00	0.00	40.30	4.79	R
3176	4571	0.731417	GCAAGGTAGATGCAGCAGTG	59.269	55.0	4.07	0.00	43.29	3.66	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
41	42	3.563508	CAAAATGCATAACGCTCACACA	58.436	40.909	0.00	0.00	43.06	3.72
163	164	0.819259	AACTGCAGTTGCCATGTCGT	60.819	50.000	30.66	2.58	41.18	4.34
318	320	9.777297	ATAGTTGCCATGATTTAAAAACTTTGT	57.223	25.926	0.00	0.00	0.00	2.83
410	412	1.123928	CCTTAGGAGTGGCCACCTAG	58.876	60.000	32.29	19.97	39.48	3.02
476	480	5.063564	GCAAAACAACATGTTCGGGTAAAAA	59.936	36.000	8.48	0.00	40.14	1.94
479	483	5.838531	ACAACATGTTCGGGTAAAAAGAA	57.161	34.783	8.48	0.00	0.00	2.52
547	552	2.035704	CCTGCAAAACACATGGCAACTA	59.964	45.455	0.00	0.00	35.59	2.24
627	636	2.627221	TGCCATGTACACTGCAAAACAT	59.373	40.909	16.42	0.00	32.91	2.71
654	663	2.203480	GGCAGCTTGGGTGTGGAA	60.203	61.111	0.00	0.00	33.19	3.53
730	741	2.222213	CGTGAATGAAAACTGGCGTGTA	59.778	45.455	0.00	0.00	0.00	2.90
747	758	1.000060	TGTAGGCGAACTGCTAAACGT	60.000	47.619	0.00	0.00	45.43	3.99
753	764	1.455786	CGAACTGCTAAACGTCCACAG	59.544	52.381	0.00	0.00	0.00	3.66
760	771	1.746322	TAAACGTCCACAGACCGGCA	61.746	55.000	0.00	0.00	40.12	5.69
788	801	0.389757	TGATGAAACGGACGTGTGGA	59.610	50.000	0.00	0.00	0.00	4.02
816	829	1.604593	GAATGCCCACACACCAGCT	60.605	57.895	0.00	0.00	0.00	4.24
835	848	1.480954	CTTAGTCCTACGTGGCACCAT	59.519	52.381	12.86	2.92	35.26	3.55
879	892	1.813753	CAAACGGACGCGGATCCAT	60.814	57.895	12.47	0.00	38.87	3.41
881	894	2.515996	AAACGGACGCGGATCCATGT	62.516	55.000	12.47	9.21	38.87	3.21
886	899	0.179121	GACGCGGATCCATGTGTGTA	60.179	55.000	12.47	0.00	0.00	2.90
909	922	1.228245	AGATGCAAACGCCCACACT	60.228	52.632	0.00	0.00	0.00	3.55
928	941	2.940410	ACTTGTGGGTGTTAGTGTTTCG	59.060	45.455	0.00	0.00	0.00	3.46
987	1000	3.134792	GGCGAGGCGAGTGAGAGA	61.135	66.667	0.00	0.00	0.00	3.10
988	1001	2.407210	GCGAGGCGAGTGAGAGAG	59.593	66.667	0.00	0.00	0.00	3.20
994	1007	0.885196	GGCGAGTGAGAGAGTCAACT	59.115	55.000	0.00	0.00	36.74	3.16
1310	1323	2.584608	CCTCCCCAAGGTGCGTAG	59.415	66.667	0.00	0.00	40.67	3.51

Showing 1 to 25 of 76 entries

Previous1 2 3 4Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
35	36	0.681733	GGCTGAGAGAGGTTGTGTGA	59.318	55.000	0.00	0.00	0.00	3.58
41	42	1.562783	GTAGGTGGCTGAGAGAGGTT	58.437	55.000	0.00	0.00	0.00	3.50
163	164	2.805671	CGACATGGCAACTGTAGTTCAA	59.194	45.455	0.00	0.00	35.83	2.69
222	223	1.277273	CTGGCACTTGACCTGAGATGA	59.723	52.381	0.00	0.00	0.00	2.92
431	433	3.119291	CCATGTCTCTTTGTAGCGCTAG	58.881	50.000	19.48	8.15	0.00	3.42
627	636	0.966875	CCAAGCTGCCAGTTGCCATA	60.967	55.000	0.00	0.00	40.16	2.74
654	663	2.600769	ACACGCCCGTCTCCTCTT	60.601	61.111	0.00	0.00	0.00	2.85
730	741	0.669625	GGACGTTTAGCAGTTCGCCT	60.670	55.000	0.00	0.00	44.04	5.52
747	758	2.847234	AAGGTGCCGGTCTGTGGA	60.847	61.111	1.90	0.00	0.00	4.02
760	771	1.069513	TCCGTTTCATCACACGAAGGT	59.930	47.619	0.00	0.00	38.76	3.50
788	801	4.404098	GGGCATTCACCCGGTCGT	62.404	66.667	0.00	0.00	40.98	4.34
816	829	1.563924	ATGGTGCCACGTAGGACTAA	58.436	50.000	5.55	0.00	41.22	2.24
835	848	4.083537	GGTGCACGAATCTTGACATGTTTA	60.084	41.667	11.45	0.00	0.00	2.01
879	892	0.320050	TTGCATCTCGCCTACACACA	59.680	50.000	0.00	0.00	41.33	3.72
881	894	1.438651	GTTTGCATCTCGCCTACACA	58.561	50.000	0.00	0.00	41.33	3.72
909	922	2.093075	TCCGAAACACTAACACCCACAA	60.093	45.455	0.00	0.00	0.00	3.33
943	956	1.300697	GTGCTTTGTCGGACTCGGT	60.301	57.895	9.88	0.00	36.95	4.69
994	1007	3.458163	GCCGGACTCCATGGTCGA	61.458	66.667	12.58	0.00	37.12	4.20
996	1009	4.530857	CCGCCGGACTCCATGGTC	62.531	72.222	12.58	2.28	35.66	4.02
1310	1323	3.254411	CCAAGGAAGAAGAAACCAAGAGC	59.746	47.826	0.00	0.00	0.00	4.09
1339	1373	2.049985	GCGTCAGTGCGTCACTCT	60.050	61.111	9.15	0.00	43.43	3.24
1523	1558	0.108804	ACTGCGTGATGTAGAACCCG	60.109	55.000	0.00	0.00	33.97	5.28
1558	1593	3.907474	TCAGAATACACCTGGAACCAAGA	59.093	43.478	0.00	0.00	32.73	3.02
1562	1597	3.983044	AGTCAGAATACACCTGGAACC	57.017	47.619	0.00	0.00	32.73	3.62
1584	1619	6.129053	AGAAGAAGAATGAATGCCGAAATC	57.871	37.500	0.00	0.00	0.00	2.17

Showing 1 to 25 of 72 entries

Previous1 2 3Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.