Multiple sequence alignment - TraesCS5D01G060800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G060800 chr5D 100.000 2618 0 0 1 2618 57818863 57821480 0.000000e+00 4835.0
1 TraesCS5D01G060800 chr5B 97.347 2639 45 8 3 2618 60826677 60824041 0.000000e+00 4462.0
2 TraesCS5D01G060800 chr1B 92.576 1980 105 16 669 2618 70232782 70234749 0.000000e+00 2804.0
3 TraesCS5D01G060800 chr1B 90.483 2070 155 25 581 2617 4954565 4952505 0.000000e+00 2693.0
4 TraesCS5D01G060800 chr1B 90.195 2050 163 18 561 2595 4519104 4517078 0.000000e+00 2638.0
5 TraesCS5D01G060800 chr1B 90.283 2017 160 19 561 2563 4110073 4112067 0.000000e+00 2606.0
6 TraesCS5D01G060800 chr1B 85.294 204 26 4 310 510 538505598 538505800 9.500000e-50 207.0
7 TraesCS5D01G060800 chr1B 77.230 426 39 30 106 503 46691055 46691450 2.060000e-46 196.0
8 TraesCS5D01G060800 chr1B 81.938 227 25 13 310 536 4519310 4519100 7.450000e-41 178.0
9 TraesCS5D01G060800 chr1B 76.533 375 35 25 184 536 4143802 4144145 3.490000e-34 156.0
10 TraesCS5D01G060800 chr1B 77.857 280 29 18 258 530 4542967 4542714 2.720000e-30 143.0
11 TraesCS5D01G060800 chr1B 95.918 49 2 0 1 49 4143604 4143652 2.160000e-11 80.5
12 TraesCS5D01G060800 chr1B 97.436 39 1 0 1 39 4109159 4109197 1.680000e-07 67.6
13 TraesCS5D01G060800 chr7A 88.109 2279 168 45 338 2597 631984116 631986310 0.000000e+00 2612.0
14 TraesCS5D01G060800 chr3D 89.639 2075 175 21 561 2618 560024990 560022939 0.000000e+00 2604.0
15 TraesCS5D01G060800 chr6B 89.456 2077 162 23 561 2618 120595530 120593492 0.000000e+00 2569.0
16 TraesCS5D01G060800 chr6B 89.089 2053 169 22 561 2604 120355193 120353187 0.000000e+00 2499.0
17 TraesCS5D01G060800 chr6D 89.451 2076 159 27 561 2618 51342823 51344856 0.000000e+00 2566.0
18 TraesCS5D01G060800 chr6D 80.973 226 16 14 312 536 51067892 51068091 1.250000e-33 154.0
19 TraesCS5D01G060800 chrUn 81.395 258 20 15 296 536 361631325 361631571 4.450000e-43 185.0
20 TraesCS5D01G060800 chr1A 81.395 258 20 15 296 536 2942920 2943166 4.450000e-43 185.0
21 TraesCS5D01G060800 chr1A 83.871 93 8 4 245 334 3542170 3542082 6.010000e-12 82.4
22 TraesCS5D01G060800 chr1D 83.636 110 10 6 295 396 361672966 361673075 2.140000e-16 97.1
23 TraesCS5D01G060800 chr3B 95.349 43 2 0 638 680 318290074 318290116 4.680000e-08 69.4
24 TraesCS5D01G060800 chr3B 97.500 40 1 0 641 680 762526135 762526096 4.680000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G060800 chr5D 57818863 57821480 2617 False 4835.0 4835 100.0000 1 2618 1 chr5D.!!$F1 2617
1 TraesCS5D01G060800 chr5B 60824041 60826677 2636 True 4462.0 4462 97.3470 3 2618 1 chr5B.!!$R1 2615
2 TraesCS5D01G060800 chr1B 70232782 70234749 1967 False 2804.0 2804 92.5760 669 2618 1 chr1B.!!$F2 1949
3 TraesCS5D01G060800 chr1B 4952505 4954565 2060 True 2693.0 2693 90.4830 581 2617 1 chr1B.!!$R2 2036
4 TraesCS5D01G060800 chr1B 4517078 4519310 2232 True 1408.0 2638 86.0665 310 2595 2 chr1B.!!$R3 2285
5 TraesCS5D01G060800 chr1B 4109159 4112067 2908 False 1336.8 2606 93.8595 1 2563 2 chr1B.!!$F4 2562
6 TraesCS5D01G060800 chr7A 631984116 631986310 2194 False 2612.0 2612 88.1090 338 2597 1 chr7A.!!$F1 2259
7 TraesCS5D01G060800 chr3D 560022939 560024990 2051 True 2604.0 2604 89.6390 561 2618 1 chr3D.!!$R1 2057
8 TraesCS5D01G060800 chr6B 120593492 120595530 2038 True 2569.0 2569 89.4560 561 2618 1 chr6B.!!$R2 2057
9 TraesCS5D01G060800 chr6B 120353187 120355193 2006 True 2499.0 2499 89.0890 561 2604 1 chr6B.!!$R1 2043
10 TraesCS5D01G060800 chr6D 51342823 51344856 2033 False 2566.0 2566 89.4510 561 2618 1 chr6D.!!$F2 2057

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
885 1363 0.737715 GTCTGTCGCCAGTGTGATCC 60.738 60.0 0.0 0.0 39.82 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2106 2614 1.526887 CGTTGTTGAGCACGAGAACAT 59.473 47.619 11.12 0.0 34.56 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 1.635663 CGAATCAAAGAAGCGGCGGT 61.636 55.000 5.44 5.44 0.00 5.68
173 191 2.352421 CCTGGTTCGACATGTAGACGTT 60.352 50.000 8.29 0.00 36.76 3.99
174 192 3.314553 CTGGTTCGACATGTAGACGTTT 58.685 45.455 8.29 0.00 36.76 3.60
202 220 8.934507 TTTTTAATTCGCTTTCCTTTTCTTGA 57.065 26.923 0.00 0.00 0.00 3.02
282 695 5.622346 AAAGCCATTCTCTTCCTAGGTAG 57.378 43.478 9.08 9.09 0.00 3.18
720 1168 4.162690 GGCCCACCTGTAGCCTCG 62.163 72.222 0.00 0.00 43.62 4.63
885 1363 0.737715 GTCTGTCGCCAGTGTGATCC 60.738 60.000 0.00 0.00 39.82 3.36
963 1453 5.576447 TCTTTGGTTGTTTTCTGAACCTC 57.424 39.130 0.00 0.00 41.99 3.85
1072 1577 4.244066 CAGGACAAGTGATCTCAAGTCTG 58.756 47.826 14.90 9.86 0.00 3.51
1422 1927 3.915437 ATAACGTCAGTTGGGCTTTTG 57.085 42.857 0.00 0.00 41.35 2.44
1507 2012 4.471386 ACAATGTAGAGTGGCTGGAATACT 59.529 41.667 0.00 0.00 0.00 2.12
1528 2033 2.902705 TGGTAGGCATGGATCGTTAC 57.097 50.000 0.00 0.00 0.00 2.50
1615 2120 4.104383 TGGATGAAGCTCCAGAAGTTTT 57.896 40.909 0.00 0.00 40.43 2.43
1772 2280 0.613777 AACTTGGCCCGAAGTAGGAG 59.386 55.000 8.78 0.00 35.01 3.69
2106 2614 0.911769 ATTCAGTCCTGCCCGATTCA 59.088 50.000 0.00 0.00 0.00 2.57
2353 2862 5.645497 AGAGTCTTTGGTCATTGAGTATTGC 59.355 40.000 0.00 0.00 0.00 3.56
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
34 35 2.414612 GGAGGAGAGGAGAGGAGAGTA 58.585 57.143 0.00 0.00 0.00 2.59
282 695 8.803201 AAGCTTACTTTCTTTTCTACAATTGC 57.197 30.769 5.05 0.00 29.41 3.56
557 995 5.277779 CGTGCTGAATCTGAACCAACTTTTA 60.278 40.000 0.00 0.00 0.00 1.52
963 1453 9.025020 CAGCTGTAGCAATAAGGTAATATATCG 57.975 37.037 5.25 0.00 45.16 2.92
1072 1577 2.287608 GCTGCTTTGACACAAGGGTAAC 60.288 50.000 0.00 0.00 0.00 2.50
1112 1617 0.252197 ACGGATAGCACCCCTTTGAC 59.748 55.000 0.00 0.00 0.00 3.18
1422 1927 1.299089 GCAACCAACTGCAACCGAC 60.299 57.895 0.00 0.00 42.17 4.79
1507 2012 2.799126 AACGATCCATGCCTACCAAA 57.201 45.000 0.00 0.00 0.00 3.28
1528 2033 4.543692 CAATTCTTCACCACAAGCTCTTG 58.456 43.478 7.99 7.99 45.58 3.02
1615 2120 6.889198 TCTTTCTCTTTTCCTCTCAAACTCA 58.111 36.000 0.00 0.00 0.00 3.41
1772 2280 2.561858 ACTTCCCTAGGAGAACACGAAC 59.438 50.000 11.48 0.00 31.21 3.95
2106 2614 1.526887 CGTTGTTGAGCACGAGAACAT 59.473 47.619 11.12 0.00 34.56 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.