Multiple sequence alignment - TraesCS5D01G056500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G056500 chr5D 100.000 2459 0 0 1 2459 52374407 52371949 0 4542
1 TraesCS5D01G056500 chr5D 97.929 2462 28 3 1 2459 422770488 422772929 0 4242
2 TraesCS5D01G056500 chr5D 97.323 2465 31 7 1 2459 282366386 282368821 0 4154
3 TraesCS5D01G056500 chr5D 97.153 2459 30 4 1 2459 356119376 356116958 0 4117
4 TraesCS5D01G056500 chr3D 97.926 2459 28 3 1 2459 52842562 52844997 0 4237
5 TraesCS5D01G056500 chr3D 98.345 1269 17 2 199 1467 534219379 534218115 0 2224
6 TraesCS5D01G056500 chr3D 96.695 938 14 1 1522 2459 534218112 534217192 0 1544
7 TraesCS5D01G056500 chr7D 97.888 2462 26 3 1 2459 634767962 634770400 0 4235
8 TraesCS5D01G056500 chr7D 97.235 2459 25 6 1 2459 426837116 426834701 0 4124
9 TraesCS5D01G056500 chr7D 96.921 2468 44 6 1 2459 538836171 538838615 0 4108
10 TraesCS5D01G056500 chr7D 96.764 2472 50 4 1 2459 112191189 112188735 0 4095
11 TraesCS5D01G056500 chr7D 97.050 1593 32 6 1 1579 445229045 445230636 0 2667
12 TraesCS5D01G056500 chr4D 97.693 2471 26 5 1 2459 392724726 392722275 0 4218


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G056500 chr5D 52371949 52374407 2458 True 4542 4542 100.000 1 2459 1 chr5D.!!$R1 2458
1 TraesCS5D01G056500 chr5D 422770488 422772929 2441 False 4242 4242 97.929 1 2459 1 chr5D.!!$F2 2458
2 TraesCS5D01G056500 chr5D 282366386 282368821 2435 False 4154 4154 97.323 1 2459 1 chr5D.!!$F1 2458
3 TraesCS5D01G056500 chr5D 356116958 356119376 2418 True 4117 4117 97.153 1 2459 1 chr5D.!!$R2 2458
4 TraesCS5D01G056500 chr3D 52842562 52844997 2435 False 4237 4237 97.926 1 2459 1 chr3D.!!$F1 2458
5 TraesCS5D01G056500 chr3D 534217192 534219379 2187 True 1884 2224 97.520 199 2459 2 chr3D.!!$R1 2260
6 TraesCS5D01G056500 chr7D 634767962 634770400 2438 False 4235 4235 97.888 1 2459 1 chr7D.!!$F3 2458
7 TraesCS5D01G056500 chr7D 426834701 426837116 2415 True 4124 4124 97.235 1 2459 1 chr7D.!!$R2 2458
8 TraesCS5D01G056500 chr7D 538836171 538838615 2444 False 4108 4108 96.921 1 2459 1 chr7D.!!$F2 2458
9 TraesCS5D01G056500 chr7D 112188735 112191189 2454 True 4095 4095 96.764 1 2459 1 chr7D.!!$R1 2458
10 TraesCS5D01G056500 chr7D 445229045 445230636 1591 False 2667 2667 97.050 1 1579 1 chr7D.!!$F1 1578
11 TraesCS5D01G056500 chr4D 392722275 392724726 2451 True 4218 4218 97.693 1 2459 1 chr4D.!!$R1 2458

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1245 1289 7.436118 CAAAGATTGAGGTTCAAATGGAGAAA 58.564 34.615 0.0 0.0 40.12 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2424 2472 0.921896 ATTGGGCTGGTAGATGCAGT 59.078 50.0 0.0 0.0 0.0 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1245 1289 7.436118 CAAAGATTGAGGTTCAAATGGAGAAA 58.564 34.615 0.00 0.00 40.12 2.52
1616 1661 4.345257 CCTAAGCCTAAGAACTGCCTATGA 59.655 45.833 0.00 0.00 0.00 2.15
1737 1782 7.857404 AGAACCTTATTATCTAAGCCTGCTA 57.143 36.000 0.00 0.00 0.00 3.49
1779 1824 3.685139 ATCCTACCTGCAATATGGTCG 57.315 47.619 0.00 0.00 37.74 4.79
1888 1933 7.487822 AGGTAGCATTACATAGATAGCACAT 57.512 36.000 0.00 0.00 0.00 3.21
1889 1934 8.595362 AGGTAGCATTACATAGATAGCACATA 57.405 34.615 0.00 0.00 0.00 2.29
1890 1935 8.690884 AGGTAGCATTACATAGATAGCACATAG 58.309 37.037 0.00 0.00 0.00 2.23
1891 1936 7.923344 GGTAGCATTACATAGATAGCACATAGG 59.077 40.741 0.00 0.00 0.00 2.57
1892 1937 7.724490 AGCATTACATAGATAGCACATAGGA 57.276 36.000 0.00 0.00 0.00 2.94
1893 1938 7.780064 AGCATTACATAGATAGCACATAGGAG 58.220 38.462 0.00 0.00 0.00 3.69
1894 1939 7.398618 AGCATTACATAGATAGCACATAGGAGT 59.601 37.037 0.00 0.00 0.00 3.85
1895 1940 8.037758 GCATTACATAGATAGCACATAGGAGTT 58.962 37.037 0.00 0.00 0.00 3.01
1896 1941 9.579768 CATTACATAGATAGCACATAGGAGTTC 57.420 37.037 0.00 0.00 0.00 3.01
1897 1942 8.706322 TTACATAGATAGCACATAGGAGTTCA 57.294 34.615 0.00 0.00 0.00 3.18
1898 1943 6.987386 ACATAGATAGCACATAGGAGTTCAC 58.013 40.000 0.00 0.00 0.00 3.18
1899 1944 6.780031 ACATAGATAGCACATAGGAGTTCACT 59.220 38.462 0.00 0.00 0.00 3.41
1900 1945 5.528043 AGATAGCACATAGGAGTTCACTG 57.472 43.478 0.00 0.00 0.00 3.66
1901 1946 5.204292 AGATAGCACATAGGAGTTCACTGA 58.796 41.667 0.00 0.00 0.00 3.41
1902 1947 5.658634 AGATAGCACATAGGAGTTCACTGAA 59.341 40.000 0.00 0.00 0.00 3.02
1903 1948 3.931578 AGCACATAGGAGTTCACTGAAC 58.068 45.455 13.25 13.25 42.25 3.18
1904 1949 3.324846 AGCACATAGGAGTTCACTGAACA 59.675 43.478 21.39 3.78 44.11 3.18
2108 2153 0.895100 GATTTGGCTGCACCTCCACA 60.895 55.000 0.50 0.00 40.22 4.17
2210 2258 0.096108 GTAGGTCGTCGTCGTCTTCC 59.904 60.000 1.33 1.85 38.33 3.46
2424 2472 3.100671 GCCTTCTTCCTCACTTCCTCTA 58.899 50.000 0.00 0.00 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1245 1289 5.994668 CCTCTGTTCTTTCTTCAGCTTAAGT 59.005 40.000 7.51 0.00 0.00 2.24
1616 1661 6.183360 ACACCACAACCAAAATGATCTGAAAT 60.183 34.615 0.00 0.00 0.00 2.17
1779 1824 7.753132 TGTGAAATGTTACAACAAACTTCTCAC 59.247 33.333 0.00 6.72 43.03 3.51
2108 2153 3.702792 TGAAGACGAAGAGGAAGAGGAT 58.297 45.455 0.00 0.00 0.00 3.24
2424 2472 0.921896 ATTGGGCTGGTAGATGCAGT 59.078 50.000 0.00 0.00 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.