Multiple sequence alignment - TraesCS5D01G052100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G052100 chr5D 100.000 4499 0 0 1 4499 50201536 50197038 0.000000e+00 8309.0
1 TraesCS5D01G052100 chr5D 96.982 4539 65 21 1 4499 49764879 49760373 0.000000e+00 7557.0
2 TraesCS5D01G052100 chr5D 98.098 3259 49 8 1242 4499 50039183 50035937 0.000000e+00 5662.0
3 TraesCS5D01G052100 chr5D 96.735 582 17 2 1 580 50040442 50039861 0.000000e+00 968.0
4 TraesCS5D01G052100 chr5D 87.619 210 18 7 3914 4118 171681120 171681326 2.090000e-58 237.0
5 TraesCS5D01G052100 chr5D 89.231 65 6 1 2107 2170 45487978 45487914 3.730000e-11 80.5
6 TraesCS5D01G052100 chr5D 100.000 31 0 0 4130 4160 171681409 171681439 1.750000e-04 58.4
7 TraesCS5D01G052100 chr5A 97.063 4528 85 19 1 4499 39245506 39240998 0.000000e+00 7581.0
8 TraesCS5D01G052100 chr5A 90.000 220 15 5 4166 4378 708833768 708833549 1.230000e-70 278.0
9 TraesCS5D01G052100 chr5A 87.970 133 11 3 3992 4119 490149654 490149786 7.790000e-33 152.0
10 TraesCS5D01G052100 chr5A 77.990 209 36 7 2050 2256 36365651 36365451 6.110000e-24 122.0
11 TraesCS5D01G052100 chr5B 95.662 3043 73 19 912 3918 52649891 52646872 0.000000e+00 4833.0
12 TraesCS5D01G052100 chr5B 95.521 3014 76 19 912 3889 52915053 52918043 0.000000e+00 4763.0
13 TraesCS5D01G052100 chr5B 97.168 565 7 5 3940 4499 52646698 52646138 0.000000e+00 946.0
14 TraesCS5D01G052100 chr5B 90.991 444 37 3 271 713 52913112 52913553 3.000000e-166 595.0
15 TraesCS5D01G052100 chr5B 89.865 444 41 4 271 713 52651833 52651393 6.530000e-158 568.0
16 TraesCS5D01G052100 chr5B 90.148 203 9 4 711 912 52650835 52650643 2.080000e-63 254.0
17 TraesCS5D01G052100 chr5B 90.148 203 9 4 711 912 52914109 52914301 2.080000e-63 254.0
18 TraesCS5D01G052100 chr5B 91.228 114 10 0 4386 4499 676178044 676177931 6.030000e-34 156.0
19 TraesCS5D01G052100 chr5B 79.894 189 27 8 2050 2236 45538274 45538095 1.310000e-25 128.0
20 TraesCS5D01G052100 chrUn 97.244 1814 34 2 2077 3889 371433358 371431560 0.000000e+00 3059.0
21 TraesCS5D01G052100 chrUn 92.492 919 30 13 926 1809 460220116 460221030 0.000000e+00 1279.0
22 TraesCS5D01G052100 chr4A 87.459 606 65 6 38 640 37772260 37771663 0.000000e+00 688.0
23 TraesCS5D01G052100 chr4A 90.179 224 20 1 4157 4378 261150484 261150707 1.580000e-74 291.0
24 TraesCS5D01G052100 chr2B 88.351 558 57 7 87 639 91033229 91033783 0.000000e+00 664.0
25 TraesCS5D01G052100 chr4B 78.699 615 102 26 38 639 621961252 621960654 2.540000e-102 383.0
26 TraesCS5D01G052100 chr3B 90.865 208 17 1 4166 4371 458277286 458277079 1.230000e-70 278.0
27 TraesCS5D01G052100 chr3B 90.076 131 8 3 3992 4119 458277560 458277432 1.000000e-36 165.0
28 TraesCS5D01G052100 chr1B 85.774 239 30 3 377 615 554692345 554692579 2.690000e-62 250.0
29 TraesCS5D01G052100 chr6D 87.850 214 16 8 3914 4121 14025263 14025472 4.500000e-60 243.0
30 TraesCS5D01G052100 chr6D 92.941 85 5 1 2917 3000 90111901 90111817 6.110000e-24 122.0
31 TraesCS5D01G052100 chr6D 100.000 29 0 0 4130 4158 14025530 14025558 2.000000e-03 54.7
32 TraesCS5D01G052100 chr2A 90.909 165 13 2 34 197 772955262 772955099 2.110000e-53 220.0
33 TraesCS5D01G052100 chr2A 95.946 74 3 0 4426 4499 527320832 527320905 2.200000e-23 121.0
34 TraesCS5D01G052100 chr2A 79.825 114 12 1 4386 4499 740649763 740649661 6.240000e-09 73.1
35 TraesCS5D01G052100 chr2A 100.000 30 0 0 4130 4159 720953846 720953875 6.290000e-04 56.5
36 TraesCS5D01G052100 chr2D 90.303 165 14 2 34 197 647525439 647525602 9.800000e-52 215.0
37 TraesCS5D01G052100 chr2D 91.765 85 7 0 2916 3000 425742653 425742569 7.910000e-23 119.0
38 TraesCS5D01G052100 chr1A 92.308 143 9 2 3167 3308 547018797 547018656 7.630000e-48 202.0
39 TraesCS5D01G052100 chr1A 92.754 138 9 1 3169 3306 388684886 388685022 9.870000e-47 198.0
40 TraesCS5D01G052100 chr1A 91.367 139 11 1 60 197 495450790 495450652 5.940000e-44 189.0
41 TraesCS5D01G052100 chr3D 92.308 143 6 5 3169 3309 568066364 568066225 9.870000e-47 198.0
42 TraesCS5D01G052100 chr7A 86.861 137 13 3 3988 4119 454755053 454755189 1.010000e-31 148.0
43 TraesCS5D01G052100 chr7A 90.090 111 11 0 4389 4499 422041561 422041671 1.300000e-30 145.0
44 TraesCS5D01G052100 chr7A 85.470 117 17 0 4379 4495 599245358 599245474 6.110000e-24 122.0
45 TraesCS5D01G052100 chr7A 85.321 109 16 0 4386 4494 597755678 597755570 3.680000e-21 113.0
46 TraesCS5D01G052100 chr7A 100.000 28 0 0 4132 4159 454755272 454755299 8.000000e-03 52.8
47 TraesCS5D01G052100 chr6A 88.710 124 9 4 3914 4035 15379790 15379910 3.630000e-31 147.0
48 TraesCS5D01G052100 chr6B 91.765 85 6 1 2917 3000 172738845 172738929 2.840000e-22 117.0
49 TraesCS5D01G052100 chr7D 95.775 71 3 0 338 408 552322617 552322547 1.020000e-21 115.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G052100 chr5D 50197038 50201536 4498 True 8309.000000 8309 100.00000 1 4499 1 chr5D.!!$R3 4498
1 TraesCS5D01G052100 chr5D 49760373 49764879 4506 True 7557.000000 7557 96.98200 1 4499 1 chr5D.!!$R2 4498
2 TraesCS5D01G052100 chr5D 50035937 50040442 4505 True 3315.000000 5662 97.41650 1 4499 2 chr5D.!!$R4 4498
3 TraesCS5D01G052100 chr5A 39240998 39245506 4508 True 7581.000000 7581 97.06300 1 4499 1 chr5A.!!$R2 4498
4 TraesCS5D01G052100 chr5B 52913112 52918043 4931 False 1870.666667 4763 92.22000 271 3889 3 chr5B.!!$F1 3618
5 TraesCS5D01G052100 chr5B 52646138 52651833 5695 True 1650.250000 4833 93.21075 271 4499 4 chr5B.!!$R3 4228
6 TraesCS5D01G052100 chrUn 371431560 371433358 1798 True 3059.000000 3059 97.24400 2077 3889 1 chrUn.!!$R1 1812
7 TraesCS5D01G052100 chrUn 460220116 460221030 914 False 1279.000000 1279 92.49200 926 1809 1 chrUn.!!$F1 883
8 TraesCS5D01G052100 chr4A 37771663 37772260 597 True 688.000000 688 87.45900 38 640 1 chr4A.!!$R1 602
9 TraesCS5D01G052100 chr2B 91033229 91033783 554 False 664.000000 664 88.35100 87 639 1 chr2B.!!$F1 552
10 TraesCS5D01G052100 chr4B 621960654 621961252 598 True 383.000000 383 78.69900 38 639 1 chr4B.!!$R1 601

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
184 186 0.096454 GCGCCGGTAGTAGCAAAAAG 59.904 55.000 1.90 0.0 0.0 2.27 F
946 2288 0.179171 GAGTCTCCGCAATCGTCGAA 60.179 55.000 0.00 0.0 0.0 3.71 F
1048 2398 0.316689 CAAGACAACCGGCGACAAAC 60.317 55.000 9.30 0.0 0.0 2.93 F
1099 2449 0.322277 ACAGTCGTCGCCTCTTCCTA 60.322 55.000 0.00 0.0 0.0 2.94 F
1737 3131 0.676151 GCTCAAGGTGCCAAGGAGAG 60.676 60.000 7.62 0.0 0.0 3.20 F
1946 3340 3.072330 TGAGCAGTGACCACTTTTATCCA 59.928 43.478 0.00 0.0 40.2 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1144 2494 0.026803 GAACTGTTCATGATCGCGCC 59.973 55.000 15.34 0.00 0.00 6.53 R
1946 3340 2.341846 ACAACAGTCCGACACCATTT 57.658 45.000 0.40 0.00 0.00 2.32 R
2870 4265 5.049129 AGACAAGAGACAAAACAATGCTAGC 60.049 40.000 8.10 8.10 0.00 3.42 R
3176 4571 2.950433 TGACAAGTATTTCCGGACGAC 58.050 47.619 1.83 1.95 0.00 4.34 R
3177 4572 3.193903 TGATGACAAGTATTTCCGGACGA 59.806 43.478 1.83 0.00 0.00 4.20 R
3575 4970 8.148351 CCCATGCTTCAGAATTCATTCATAATT 58.852 33.333 8.44 0.00 39.23 1.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
28 29 0.877649 AGTGCTGACGTGACTGCTTG 60.878 55.000 0.00 0.00 36.10 4.01
31 32 1.566563 CTGACGTGACTGCTTGCAC 59.433 57.895 0.00 0.00 0.00 4.57
36 37 4.600576 TGACTGCTTGCACGCGGA 62.601 61.111 28.79 6.15 39.56 5.54
95 96 2.681344 GCCGGTAGTACCAAAATCCAAG 59.319 50.000 19.41 0.00 38.47 3.61
184 186 0.096454 GCGCCGGTAGTAGCAAAAAG 59.904 55.000 1.90 0.00 0.00 2.27
946 2288 0.179171 GAGTCTCCGCAATCGTCGAA 60.179 55.000 0.00 0.00 0.00 3.71
961 2303 4.811761 GAACCATTCGCACGCCGC 62.812 66.667 0.00 0.00 36.73 6.53
1007 2357 1.622607 CCTCCGGTAACCATGGCTGA 61.623 60.000 13.04 0.00 0.00 4.26
1048 2398 0.316689 CAAGACAACCGGCGACAAAC 60.317 55.000 9.30 0.00 0.00 2.93
1099 2449 0.322277 ACAGTCGTCGCCTCTTCCTA 60.322 55.000 0.00 0.00 0.00 2.94
1144 2494 2.738846 CAGTTTGGTCTGGACAAGATCG 59.261 50.000 3.10 0.00 39.09 3.69
1435 2811 3.515286 GGATGGCGACGAGGACGA 61.515 66.667 0.00 0.00 42.66 4.20
1436 2812 2.278013 GATGGCGACGAGGACGAC 60.278 66.667 0.00 0.00 42.66 4.34
1458 2834 2.672307 AAGACGACGAGGGCGACT 60.672 61.111 0.00 0.00 41.64 4.18
1687 3081 2.799412 CACGCTCCTATTGAAGATGAGC 59.201 50.000 6.97 6.97 43.79 4.26
1737 3131 0.676151 GCTCAAGGTGCCAAGGAGAG 60.676 60.000 7.62 0.00 0.00 3.20
1815 3209 8.077386 GTGTATGAAATTCCAACCTTCGTTTTA 58.923 33.333 0.00 0.00 0.00 1.52
1946 3340 3.072330 TGAGCAGTGACCACTTTTATCCA 59.928 43.478 0.00 0.00 40.20 3.41
1956 3350 4.217550 ACCACTTTTATCCAAATGGTGTCG 59.782 41.667 0.00 0.00 36.08 4.35
2870 4265 5.529430 TGTGGGGCATATGTTTACTATTTCG 59.471 40.000 4.29 0.00 0.00 3.46
3176 4571 7.393841 TTTTGGGTTATAAATTGTACTCCCG 57.606 36.000 0.00 0.00 36.75 5.14
3177 4572 5.697082 TGGGTTATAAATTGTACTCCCGT 57.303 39.130 0.00 0.00 36.75 5.28
3964 5522 7.593825 CAACGGGAGAAATAATGTTCTTTTCT 58.406 34.615 0.00 0.00 41.20 2.52
4308 5871 3.087031 ACATGGTCATCTTGGCTCTTTG 58.913 45.455 0.00 0.00 0.00 2.77
4476 6039 3.077556 ATTGAGGCGCGGAGACCT 61.078 61.111 8.83 5.24 39.65 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
36 37 0.952497 CATTATGCCGGAGCTGCGAT 60.952 55.000 30.34 17.68 40.80 4.58
126 128 1.453762 GCGGTGGAGCTACGACCTAT 61.454 60.000 13.59 0.00 43.68 2.57
184 186 2.600122 TTTGTTGCAACCGTCGCCAC 62.600 55.000 26.14 0.00 0.00 5.01
212 214 3.183775 GCGAAAGAACTTTGCTAGAACGA 59.816 43.478 4.48 0.00 32.11 3.85
496 519 1.450360 ACTGCCCTTCTCCTTTCCTT 58.550 50.000 0.00 0.00 0.00 3.36
1099 2449 3.374402 CAGGTCGGTCAGGCGAGT 61.374 66.667 0.00 0.00 0.00 4.18
1125 2475 2.076863 CCGATCTTGTCCAGACCAAAC 58.923 52.381 0.00 0.00 32.83 2.93
1144 2494 0.026803 GAACTGTTCATGATCGCGCC 59.973 55.000 15.34 0.00 0.00 6.53
1435 2811 2.675056 CCCTCGTCGTCTTCGTCGT 61.675 63.158 7.05 0.00 45.27 4.34
1436 2812 2.097918 CCCTCGTCGTCTTCGTCG 59.902 66.667 0.00 1.62 46.06 5.12
1437 2813 2.202453 GCCCTCGTCGTCTTCGTC 60.202 66.667 0.00 0.00 38.33 4.20
1453 2829 1.571919 GTCCACATCCACATAGTCGC 58.428 55.000 0.00 0.00 0.00 5.19
1458 2834 0.464036 GCCTCGTCCACATCCACATA 59.536 55.000 0.00 0.00 0.00 2.29
1687 3081 2.559668 TCTTTGGCTTCTTGCATTCCAG 59.440 45.455 0.00 0.00 45.15 3.86
1737 3131 2.674220 CCCTCCAGCCTCAGGTTCC 61.674 68.421 0.00 0.00 0.00 3.62
1815 3209 6.648879 AGTGTTGGTGCAATGTTAAGTTAT 57.351 33.333 0.00 0.00 0.00 1.89
1946 3340 2.341846 ACAACAGTCCGACACCATTT 57.658 45.000 0.40 0.00 0.00 2.32
2870 4265 5.049129 AGACAAGAGACAAAACAATGCTAGC 60.049 40.000 8.10 8.10 0.00 3.42
3176 4571 2.950433 TGACAAGTATTTCCGGACGAC 58.050 47.619 1.83 1.95 0.00 4.34
3177 4572 3.193903 TGATGACAAGTATTTCCGGACGA 59.806 43.478 1.83 0.00 0.00 4.20
3575 4970 8.148351 CCCATGCTTCAGAATTCATTCATAATT 58.852 33.333 8.44 0.00 39.23 1.40
3964 5522 8.630917 GCATAGGTACTTGAGTTAAGAGACATA 58.369 37.037 0.99 2.24 41.75 2.29
4476 6039 2.493500 CCTACCAGATGAGGGGAGCATA 60.494 54.545 0.00 0.00 34.81 3.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.