Multiple sequence alignment - TraesCS5D01G037400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G037400 chr5D 100.000 2492 0 0 1 2492 36561905 36564396 0 4602
1 TraesCS5D01G037400 chr6D 96.715 2496 72 10 1 2492 257991972 257994461 0 4146
2 TraesCS5D01G037400 chr6D 97.408 2122 52 3 372 2492 305380477 305378358 0 3611
3 TraesCS5D01G037400 chr2B 93.596 2514 112 22 1 2492 655694290 655691804 0 3705
4 TraesCS5D01G037400 chr4B 93.442 2516 112 25 1 2492 15516589 15519075 0 3683
5 TraesCS5D01G037400 chr3B 93.241 2515 115 27 2 2492 60566600 60569083 0 3651
6 TraesCS5D01G037400 chr3B 90.843 2206 125 38 1 2157 754458891 754461068 0 2883
7 TraesCS5D01G037400 chr2D 95.727 2270 84 12 1 2264 87947933 87950195 0 3642
8 TraesCS5D01G037400 chr6A 93.138 2521 109 26 9 2492 602797817 602795324 0 3639
9 TraesCS5D01G037400 chr3D 92.526 2502 158 26 1 2492 305617877 305615395 0 3557
10 TraesCS5D01G037400 chr5A 90.294 2483 188 38 1 2459 671452818 671455271 0 3201
11 TraesCS5D01G037400 chr2A 87.500 856 47 31 1 833 15750767 15749949 0 933
12 TraesCS5D01G037400 chr2A 86.782 870 48 30 1 833 30580157 30580996 0 907
13 TraesCS5D01G037400 chr2A 89.233 743 44 24 1 711 614073 613335 0 896


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G037400 chr5D 36561905 36564396 2491 False 4602 4602 100.000 1 2492 1 chr5D.!!$F1 2491
1 TraesCS5D01G037400 chr6D 257991972 257994461 2489 False 4146 4146 96.715 1 2492 1 chr6D.!!$F1 2491
2 TraesCS5D01G037400 chr6D 305378358 305380477 2119 True 3611 3611 97.408 372 2492 1 chr6D.!!$R1 2120
3 TraesCS5D01G037400 chr2B 655691804 655694290 2486 True 3705 3705 93.596 1 2492 1 chr2B.!!$R1 2491
4 TraesCS5D01G037400 chr4B 15516589 15519075 2486 False 3683 3683 93.442 1 2492 1 chr4B.!!$F1 2491
5 TraesCS5D01G037400 chr3B 60566600 60569083 2483 False 3651 3651 93.241 2 2492 1 chr3B.!!$F1 2490
6 TraesCS5D01G037400 chr3B 754458891 754461068 2177 False 2883 2883 90.843 1 2157 1 chr3B.!!$F2 2156
7 TraesCS5D01G037400 chr2D 87947933 87950195 2262 False 3642 3642 95.727 1 2264 1 chr2D.!!$F1 2263
8 TraesCS5D01G037400 chr6A 602795324 602797817 2493 True 3639 3639 93.138 9 2492 1 chr6A.!!$R1 2483
9 TraesCS5D01G037400 chr3D 305615395 305617877 2482 True 3557 3557 92.526 1 2492 1 chr3D.!!$R1 2491
10 TraesCS5D01G037400 chr5A 671452818 671455271 2453 False 3201 3201 90.294 1 2459 1 chr5A.!!$F1 2458
11 TraesCS5D01G037400 chr2A 15749949 15750767 818 True 933 933 87.500 1 833 1 chr2A.!!$R2 832
12 TraesCS5D01G037400 chr2A 30580157 30580996 839 False 907 907 86.782 1 833 1 chr2A.!!$F1 832
13 TraesCS5D01G037400 chr2A 613335 614073 738 True 896 896 89.233 1 711 1 chr2A.!!$R1 710

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
917 1051 1.81186 CTGTGCTATTGGCTTGCCC 59.188 57.895 9.35 0.0 42.39 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1736 1877 1.77411 ACATGGCTTGTCAACCAACA 58.226 45.0 9.88 0.0 39.96 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 157 6.239402 CCTTCACCATGATCCAAGAAAAGTTT 60.239 38.462 0.00 0.0 0.00 2.66
314 398 9.811995 ACCTAAAACTGTCAATTTAAGTTTTCC 57.188 29.630 18.77 0.0 46.09 3.13
422 517 8.972127 TCTAACACTAAACATGCTCTATTCTCT 58.028 33.333 0.00 0.0 0.00 3.10
423 518 9.243637 CTAACACTAAACATGCTCTATTCTCTC 57.756 37.037 0.00 0.0 0.00 3.20
451 546 4.335416 TGGGAGTGAATTCCATTCTGAAC 58.665 43.478 2.27 0.0 39.96 3.18
917 1051 1.811860 CTGTGCTATTGGCTTGCCC 59.188 57.895 9.35 0.0 42.39 5.36
1074 1211 1.067516 ACACAACATGCTGCTGGAAAC 59.932 47.619 0.00 0.0 0.00 2.78
1310 1449 2.761767 TGGGTGCTGAAAATGATGATGG 59.238 45.455 0.00 0.0 0.00 3.51
1501 1640 5.163468 TGCAACAAGTTTTGAAAGCCTGATA 60.163 36.000 0.00 0.0 0.00 2.15
1569 1708 6.151691 TGTTGAGCAAGCAAAAGATGATAAC 58.848 36.000 0.00 0.0 0.00 1.89
1597 1736 8.027524 AGATGAGGCTATTGTCTTTCTTGATA 57.972 34.615 0.00 0.0 0.00 2.15
1736 1877 1.073025 TTGGCGAGCACAACCATCT 59.927 52.632 0.00 0.0 32.39 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
59 91 5.591643 AAATTGTACTACGCAACTGTCTG 57.408 39.130 0.00 0.00 0.00 3.51
125 157 4.261572 GCAACTGTATCTTGGCAACTTTCA 60.262 41.667 0.00 0.00 37.61 2.69
313 397 6.469410 TCAGTACCTATGTTTTGTGTTAGGG 58.531 40.000 0.00 0.00 36.36 3.53
314 398 7.972832 TTCAGTACCTATGTTTTGTGTTAGG 57.027 36.000 0.00 0.00 37.75 2.69
422 517 4.656100 TGGAATTCACTCCCAAATCAGA 57.344 40.909 7.93 0.00 34.22 3.27
423 518 5.927281 AATGGAATTCACTCCCAAATCAG 57.073 39.130 7.93 0.00 34.22 2.90
451 546 6.857964 CCATAAAAGTGCTACTTTGAAGTGTG 59.142 38.462 12.87 7.51 46.78 3.82
471 567 0.332632 AAGCAAGCCTCCTGCCATAA 59.667 50.000 0.00 0.00 42.71 1.90
726 850 5.643664 TCACATGATAGCATTCTTTTGTGC 58.356 37.500 0.00 0.00 41.57 4.57
855 987 3.755378 AGCTCAATCATGTTCAACCTGTC 59.245 43.478 0.00 0.00 0.00 3.51
1074 1211 0.171007 ATTCCGCCACAAATTCTGCG 59.829 50.000 0.00 0.00 46.14 5.18
1310 1449 2.431683 TGGGCTGTGACCAAGCTC 59.568 61.111 0.00 0.00 38.06 4.09
1489 1628 4.129380 CCGTCATCAATATCAGGCTTTCA 58.871 43.478 0.00 0.00 0.00 2.69
1501 1640 0.982852 TCTGCCCCTCCGTCATCAAT 60.983 55.000 0.00 0.00 0.00 2.57
1569 1708 5.355596 AGAAAGACAATAGCCTCATCTTCG 58.644 41.667 0.00 0.00 0.00 3.79
1597 1736 7.148000 GCTCCTCTTTTTGCCTTTACTATCATT 60.148 37.037 0.00 0.00 0.00 2.57
1736 1877 1.774110 ACATGGCTTGTCAACCAACA 58.226 45.000 9.88 0.00 39.96 3.33
2130 2285 8.275632 GCAAGTTTAGATTCAACACCAAATTTC 58.724 33.333 0.00 0.00 0.00 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.