Multiple sequence alignment - TraesCS5D01G030600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5D01G030600 chr5D 100.000 4055 0 0 1 4055 28018143 28014089 0 7489
1 TraesCS5D01G030600 chr5D 98.397 4056 60 3 1 4055 449325358 449321307 0 7125
2 TraesCS5D01G030600 chr1D 98.619 4056 52 4 1 4055 288347839 288343787 0 7177
3 TraesCS5D01G030600 chr1D 98.521 4056 58 2 1 4055 26570738 26574792 0 7156
4 TraesCS5D01G030600 chr7D 98.595 4056 56 1 1 4055 596364208 596360153 0 7173
5 TraesCS5D01G030600 chr3D 98.521 4056 58 2 1 4055 567168355 567172409 0 7156
6 TraesCS5D01G030600 chr3D 98.077 4056 63 4 1 4055 111969754 111965713 0 7044
7 TraesCS5D01G030600 chrUn 98.324 4057 66 2 1 4055 89870737 89874793 0 7114
8 TraesCS5D01G030600 chr4D 98.102 4056 73 4 1 4055 108893837 108889785 0 7060
9 TraesCS5D01G030600 chr4D 98.476 3938 59 1 1 3937 505488515 505484578 0 6938


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5D01G030600 chr5D 28014089 28018143 4054 True 7489 7489 100.000 1 4055 1 chr5D.!!$R1 4054
1 TraesCS5D01G030600 chr5D 449321307 449325358 4051 True 7125 7125 98.397 1 4055 1 chr5D.!!$R2 4054
2 TraesCS5D01G030600 chr1D 288343787 288347839 4052 True 7177 7177 98.619 1 4055 1 chr1D.!!$R1 4054
3 TraesCS5D01G030600 chr1D 26570738 26574792 4054 False 7156 7156 98.521 1 4055 1 chr1D.!!$F1 4054
4 TraesCS5D01G030600 chr7D 596360153 596364208 4055 True 7173 7173 98.595 1 4055 1 chr7D.!!$R1 4054
5 TraesCS5D01G030600 chr3D 567168355 567172409 4054 False 7156 7156 98.521 1 4055 1 chr3D.!!$F1 4054
6 TraesCS5D01G030600 chr3D 111965713 111969754 4041 True 7044 7044 98.077 1 4055 1 chr3D.!!$R1 4054
7 TraesCS5D01G030600 chrUn 89870737 89874793 4056 False 7114 7114 98.324 1 4055 1 chrUn.!!$F1 4054
8 TraesCS5D01G030600 chr4D 108889785 108893837 4052 True 7060 7060 98.102 1 4055 1 chr4D.!!$R1 4054
9 TraesCS5D01G030600 chr4D 505484578 505488515 3937 True 6938 6938 98.476 1 3937 1 chr4D.!!$R2 3936

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
97 98 1.279271 AGCAGATAAACGCCAAGAGGT 59.721 47.619 0.00 0.0 37.19 3.85 F
481 483 1.610363 TTTACATCAAGCGGGCAACA 58.390 45.000 0.00 0.0 39.74 3.33 F
791 793 1.669265 CTACAGGATCTGTCGTGCGTA 59.331 52.381 3.65 0.0 41.21 4.42 F
2255 2259 0.608130 TCACCAACCCTCATCTGACG 59.392 55.000 0.00 0.0 0.00 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1105 1107 3.317149 CGATAACCATCTACCAACGGAGA 59.683 47.826 0.00 0.00 0.00 3.71 R
1659 1661 8.588290 TTGATACAAAAGGTACCAGCATATTT 57.412 30.769 15.94 1.38 34.07 1.40 R
2600 2604 1.139734 GCGTCGAGCTTCAGGATGA 59.860 57.895 0.00 0.00 43.45 2.92 R
3171 3175 1.079888 GCCCTCAACCCAAATTGCG 60.080 57.895 0.00 0.00 0.00 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
97 98 1.279271 AGCAGATAAACGCCAAGAGGT 59.721 47.619 0.00 0.00 37.19 3.85
192 193 8.744652 TCAACATCCGGTATAATTGTTTGATTT 58.255 29.630 0.00 0.00 0.00 2.17
233 235 5.426504 CATTCCTGCTTTGACTACTCTCAT 58.573 41.667 0.00 0.00 0.00 2.90
391 393 4.458295 TCCGAACTGAACTCAGGTTAGTAG 59.542 45.833 11.31 0.00 45.35 2.57
481 483 1.610363 TTTACATCAAGCGGGCAACA 58.390 45.000 0.00 0.00 39.74 3.33
791 793 1.669265 CTACAGGATCTGTCGTGCGTA 59.331 52.381 3.65 0.00 41.21 4.42
902 904 5.770685 AGAGGAGGAAGCAGAAAAAGTAT 57.229 39.130 0.00 0.00 0.00 2.12
1105 1107 8.408043 TGACATTAACAAGGAACAGATGAAAT 57.592 30.769 0.00 0.00 0.00 2.17
1217 1219 9.236006 GGGTACGACTATTTCTATATTACAGGA 57.764 37.037 0.00 0.00 0.00 3.86
1659 1661 4.342378 GGAGTCAGCTGATATGACCTACAA 59.658 45.833 21.47 0.00 46.68 2.41
2255 2259 0.608130 TCACCAACCCTCATCTGACG 59.392 55.000 0.00 0.00 0.00 4.35
2600 2604 1.633774 AACATCCCAGACACGACTCT 58.366 50.000 0.00 0.00 0.00 3.24
2905 2909 1.737236 TCTACCACAATGTGCATTCGC 59.263 47.619 8.05 0.00 39.24 4.70
3052 3056 3.390311 ACTCAAAGAAAACCCGTACTCCT 59.610 43.478 0.00 0.00 0.00 3.69
3171 3175 1.078759 CGTTGTCATCTGAGGTCGCC 61.079 60.000 0.00 0.00 0.00 5.54
3270 3274 2.094906 GCACAGTATACGTGTGACCTCA 60.095 50.000 26.22 0.00 46.99 3.86
3383 3387 5.308497 TGGAGGTTGTACTAAATCCTCAACA 59.692 40.000 12.31 2.72 44.33 3.33
3658 3663 3.134442 AGTTGTCGGTTAAGGTGGTACAA 59.866 43.478 0.00 0.00 44.16 2.41
3969 3974 3.560068 CGTGTTCTTTGGCAAACTAGAGT 59.440 43.478 8.93 0.00 0.00 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
12 13 5.694006 GGTGATATTCTCGAAAGATCCTGTG 59.306 44.000 10.39 0.00 40.84 3.66
97 98 2.626266 TCTTCCGCCGATAATTAGCTCA 59.374 45.455 0.00 0.00 0.00 4.26
192 193 7.307870 GCAGGAATGCACATTGTTTTCATTAAA 60.308 33.333 0.00 0.00 34.41 1.52
233 235 7.099764 GGTCTAATAATAGATGCAGCAAGCTA 58.900 38.462 4.07 4.92 40.21 3.32
481 483 0.534203 AACGTTGATGAGGTTGCCGT 60.534 50.000 0.00 0.00 35.20 5.68
791 793 9.620259 GATAACTTTCTTAGATGGTTTGGAGAT 57.380 33.333 5.87 0.00 0.00 2.75
902 904 2.027192 GGTCAGGTTGACTTCCATGCTA 60.027 50.000 8.89 0.00 46.19 3.49
963 965 7.564793 AGTAGTGAATGCAGGAATGTACATTA 58.435 34.615 20.83 5.78 33.07 1.90
1105 1107 3.317149 CGATAACCATCTACCAACGGAGA 59.683 47.826 0.00 0.00 0.00 3.71
1217 1219 8.019656 AGGGAGTATATTCAATAGACGTTTGT 57.980 34.615 0.00 0.00 32.47 2.83
1659 1661 8.588290 TTGATACAAAAGGTACCAGCATATTT 57.412 30.769 15.94 1.38 34.07 1.40
2600 2604 1.139734 GCGTCGAGCTTCAGGATGA 59.860 57.895 0.00 0.00 43.45 2.92
3052 3056 3.761752 GCACCCAAACTCCTAAATTGCTA 59.238 43.478 0.00 0.00 0.00 3.49
3171 3175 1.079888 GCCCTCAACCCAAATTGCG 60.080 57.895 0.00 0.00 0.00 4.85
3270 3274 3.567478 GACAAAGGGTCATATGCTCCT 57.433 47.619 9.88 9.88 46.19 3.69
3383 3387 3.595021 TCCTCATCATCATCATGGACCT 58.405 45.455 0.00 0.00 0.00 3.85
3658 3663 3.322254 ACGAATCTGTGTCTGGTTCTTCT 59.678 43.478 0.00 0.00 0.00 2.85
3927 3932 1.473257 GCGAGCCACAATATCAGGTCA 60.473 52.381 0.00 0.00 0.00 4.02
3969 3974 6.768483 TCTTGAACAACATGTCCTTCATAGA 58.232 36.000 15.38 15.90 34.67 1.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.